Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4122
Length(NT) : 1468
Best Gene Model Blast : Link to GSTUMT00005644001 E-value : 0.0
Numbers of ESTs : 73

Blast Results:

Nr Definition: ADT_NEUCR ADP,ATP CARRIER PROTEIN (ADP/ATP TRANSLOCASE) (ADENINE NUCLEOTIDE TRANSLOCATOR) (ANT)
Accession: ref|XP_386197.1| Score: 1289 E_value: 1e-140
KEGG Definition: ADT_NEUCR ADP,ATP CARRIER PROTEIN (ADP/ATP TRANSLOCASE) (ADENINE NUCLEOTIDE TRANSLOCATOR) (ANT)
Accession: fgr:FG06021.1 Score: 1289 E_value: 1e-140
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0749 Score: 1201 E_value: 1e-132
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 241 E_value: 5e-21
Swissprot: P02723|ADT_NEUCR

Sequence:
>Contig4122
TTGGCAGCCAAGACAATTTTTCTTGCCGACCTCGTTCAAAAACCCCATCT
CTTTCCCCAATCCTCCCTCCCTTCTATTCTTCTCATCCCACTCTCATCAA
GTCCGCCGAAGAGTCGTTGATCCACTCTTTACCTTTCCTACCTTTGGTTT
TCTGTTTTTGAAAAACTTCTCCCCTCACAAAACTTGTTAAAATGCCAGAA
CAATCTACTTTCCTCGTTGACTTCTTGATGGGCGGCGTTTCTGCCGCCGT
CTCGAAAACTGCTGCTGCACCCATTGAGCGTATCAAGCTCCTTATCCAGA
ACCAGGATGAAATGATTAAGGCCGGACGTCTCGACCGCAAATATGGCGGT
ATCGGAGACTGCTTCAAGCGTACTATCGCTGACGAGGGTACCGTTTCTCT
ATGGCGTGGTAACACTGCCAACGTTATCCGTTACTTCCCCACTCAGGCGT
TGAACTTTGCTTTCCGTGATAAGTTCAAGAAGATGTTCGGTTACAAGAAG
GAGCGTGATGGTTATGCCAAGTGGATGGCTGGTAACTTGGCTTCTGGTGG
TGCTGCTGGTGCTACTTCCCTCCTGTTCGTTTACTCTCTTGACTACGCCC
GTACTCGTCTCGCCAATGACGCCAAGTCTGCCAAGAAGGGTGGTGAGCGC
CAGTTCAATGGTTTGATCGACGTCTACAAGAAGACTCTAGCCTCTGATGG
TATCTCTGGTCTTTACCGTGGTTTCGGTCCTTCCGTCCTTGGTATTGTCG
TCTACCGTGGTCTGTACTTCGGTATGTACGACTCCATCAAGCCTGTCGTC
CTTACTGGCAAGCTTGAGGGCAACTTTTTAGCCTCTTTCGCCCTGGGGTG
GATAGTCACCACTGGTGCTGGTATCGCCTCTTACCCTCTTGACACAGTTC
GTCGTCGTATGATGATGACTTCTGGTGAGGCCGTCAAGTACAAGTCCTCT
CTCGATGCCTTCTCCCAGATCGTCAAAGCTGAGGGTGTTCGCTCCCTCTT
CAAGGGCGCTGGTGCCAACATCCTCCGTGGCGTCGCCGGTGCTGGCGTGT
TGTCCATCTATGATCAGGTCCAACTCCTCATGTTCGGAAAGGCCTACAAG
GGTGGATCTGGTTAAGCAAAAAAAAAAATGTCTAAAAATAGAAATGGTAT
GGGTGGATGGTAACGCAAAACCTCTTTTCAGGGATGGGAAGGGGGCTTGC
GATATGACAACTTTACCTGCTGTATACGATGCCAGGCAGGAGAAAAGAAA
TTCTACTCAGTAACAAAAGCTTTTAGTGTAATTAGGATATCTTCGTTTTA
CAATCTTTTGTTTTCCGTTGTCTCATCCTTCCTTATACATGAAGCAAATG
GCGGGGACTAAAATGTGGGTTTTCTTTGTTTTTGAGGTGTCGGTTTCAGT
TTTTCCATGGTTTAGGTTTTCATGATCAATAGAGAATGTCCTCCCATAGC
ATTTATTTGTTCATTGTG

Sequences in the Contig:

SY0AAA13YN24FM1 SY0AAA14YB09FM1 SY0AAA16YG18FM1
SY0AAA17YI02FM1 SY0AAA18YL23RM1 SY0AAA20YC11FM1
SY0AAA21YL16FM1 SY0AAA25YM01FM1 SY0AAA26YI08FM1
SY0AAA27YN01FM1 SY0AAA28YG09FM1 SY0AAA28YO19FM1
SY0AAA2YE10FM1 SY0AAA2YI23FM1 SY0AAA30YF06FM1
SY0AAA34YM07FM1 SY0AAA36YK09FM1 SY0AAA37YD12FM1
SY0AAA39YN09FM1 SY0AAA3YC18FM1 SY0AAA3YE12FM1
SY0AAA3YH16FM1 SY0AAA42YE14FM1 SY0AAA44YL10FM1
SY0AAA45YI24FM1 SY0AAA47YJ10FM1 SY0AAA49YD21FM1
SY0AAA57YJ18FM1 SY0AAA62YM16FM1 SY0AAA6YH23FM1
SY0AAB10YL18FM1 SY0AAB12YF04FM1 SY0AAB12YM16FM1
SY0AAB21YA19FM1 SY0AAB2YC11FM1 SY0AAB30YL14FM1
SY0AAB32YE21FM1 SY0AAB32YL15FM1 SY0AAB3YB02FM1
SY0AAB3YE09FM1 SY0AAB47YD13FM1 SY0AAB48YK16FM1
SY0AAB49YK23FM1 SY0AAB49YL18FM1 SY0AAB49YN17FM1
SY0AAB49YO22FM1 SY0AAB52YI07FM1 SY0AAB55YI02FM1
SY0AAB56YB23FM1 SY0AAB57YF01FM1 SY0AAB60YI03FM1
SY0AAB61YI03FM1 SY0AAC13YL09FM1 SY0AAC25YJ05FM1
SY0AAC35YB17FM1 SY0AAC40YE02FM1 SY0AAC41YL15FM1
SY0AAC52YP06FM1 SY0AAC56YD14FM1 SY0AAC61YE02FM1
SY0AAC9YI13FM1 SY0AAD18YJ21FM1 SY0AAD28YH17FM1
SY0AAD41YO10FM1 SY0AAD48YK04FM1 SY0AAD48YO13FM1
SY0AAD49YA20FM1 SY0AAD55YC16FM1 SY0AAD61YL13FM1
SY0AAD62YE08FM1 SY0AAD9YH12FM1 SY0AAD9YM09FM1
SY0AAD9YO23FM1