Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4121
Length(NT) : 332
Best Gene Model Blast : Link to GSTUMT00010244001 E-value : 2e-23
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4121
AATAAGAGGAAGGAATTCGTTAATGTATGCTCCAATACATTGAGAAATGT
GTTTCCCTCTACTCTATACTAATACCGACTGCACATATAGGACCTTTTGC
GGTCGGACTTCCATAAGCGGTTCATGAATAAATACGTACGATAGATGGGG
GCAGTGAACTTGCTGTGCTGGTGTCCTCTTATTGCGTTTCTGTTTTCTTC
TAGCCTCATAATATCCTCTCGACCGGCCAAAGGCAAATGTCTTTGTTTTC
TTGGTGGTACAGATTTGTGGCTTCCGCTCTCACCAAATTTGTAGTTTATA
GCCCTGAGAATAATCTACTTTTTGCCCTTTCT

Sequences in the Contig:

SY0AAC25YJ03RM1 SY0AAD42YA04FM1