Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4120
Length(NT) : 758
Best Gene Model Blast : Link to GSTUMT00000996001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65288.1| Score: 405 E_value: 8e-38
KEGG Definition: peptidyl-prolyl cis-trans isomerase [EC:5.2.1.8]; K09578 peptidyl-prolyl cis-trans isomerase NIMA-interacting 1
Accession: aor:AO090011000848 Score: 405 E_value: 4e-38
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3259 Score: 310 E_value: 2e-29
PFAM Definition: No Hit Found
Swissprot: O60045|SSP1_NEUCR

Sequence:
>Contig4120
TTGGAATCGATCAATATCAATCAATCAATTGCTAGGCATCGATCCGAAGA
TCCCCCCTCATTTTTTCCCCCCTTCTTTTCCCCTCCTTTTTCCTTTTTTC
GCCTAATCCCAACTGCTCGAGTACCACACCTCACCTCATCGTGATCTCTC
TCTCCACCAAAAAAAAAACGGAAATCCCGGGGTTGTTTTGCCTTACCGTA
CCACCACCACCCCATCACCATCGTCACCACCATCATCATCATCGTACCGA
AAGGGAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAGTCTACAAC
ATCACACCCCCTACCTCTCAAAACGCCCCCGATAAACTACCACCGCCACC
GTCTTTAGTTATCAAATAATCAATCAGTCATGACTTCCGAAACTGGCCTG
CCAGAGAACTGGACCATCCGGCTTTCAAAGTCCAAGGGTCTGCCCTACTA
CTTCAACACGACGACCACCGAATCGCGATGGGAGCCGCCATCCGACACAG
ACACGGATAAATTAAAGGTCTACATGGCGGAGAAATTCTCCACAGGGAAT
ACCGCCCCTCCGGAGGGAAGTGGTCAGGCCGGGAAGATTCGGTGCGCACA
TTTGCTTGTTAAGCATAAGGATAGCAGGAGACCTAGTTCTTGGAAGGAGT
CCAACATCACCAGAACAAAGGAAGACGCCATGGGGATTATCCTAGGCTTC
GAAACCCGTATTAGAGATCGCTCTACTTCGTTGGCTGATCTTGCCGTGGT
TGAGTCTG

Sequences in the Contig:

SY0AAA19YB06FM1 SY0AAB55YI12FM1 SY0AAC25YI21FM1
SY0AAC41YP21FM1 SY0AAD10YB13FM1