Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4119
Length(NT) : 600
Best Gene Model Blast : Link to GSTUMT00003809001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein HCAG_00337
Accession: ref|XP_001543291.1| Score: 824 E_value: 1e-86
KEGG Definition: mRNA cleavage factor I subunit
Accession: aor:AO090003001316 Score: 806 E_value: 8e-85
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1689 Score: 476 E_value: 8e-49
PFAM Definition: No Hit Found
Swissprot: Q7T3C6|CPSF5_DANRE
Gene Ontology:
GO:0042382 = Cellular component: paraspeckles
GO:0005515 = Molecular function: protein binding
GO:0006397 = Biological process: mRNA processing

Sequence:
>Contig4119
TTGGCGACACCAACACCGGCGATCAGGTCAACCCAACCAACGCCGAGAGC
CCTACCTCCTTTCGCCATCACTTGAACCATGTCGACGATCACTAGTACGG
CTCTCCAGAGCTCACAGGCCCCAATCCTGCCGGCTTCCTTCTCCGCCAAC
CAGCCAAAGACCATCCGTCTCTACCCGTTATCTAATTATACTTTTGGTAC
TAAGGAGAACCAACCGGAAGAAGACCCCTCTGTCCTTGCCCGTCTGCAAC
GCCTACAAGAACACTACGAGCAGTATGGTATGCGACGCACCTGTGAAGGT
ATCCTCGTTTGCCACGAGCACTGTCATCCGCACATCCTCATGCTTCAAAT
TGCCAATGCCTTCTTCAAGTTGCCAGGCGATTACCTCCACCATCACGAGA
GCGAGCTGGAAGGGTTTAAGTCTCGTCTGAACGAACGCCTTGCTCCGGTC
GGCAGCCAATTTTCCGGCGAGGGTGTTAATGATGAATGGGAGATTGGTGA
TACTCTCGCCCAGTGGTGGAGGCCAAACTTTGAGACATTCATGTACCCTT
TTATCCCGGCGCATGTCACCAGGCCCAAAGAGTGCAAGAAGCTATATTTT

Sequences in the Contig:

SY0AAA46YI13FM1 SY0AAC25YI19FM1 SY0AAD33YI12FM1