Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4118
Length(NT) : 1111
Best Gene Model Blast : Link to GSTUMT00003671001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_13379
Accession: ref|XP_001548189.1| Score: 845 E_value: 1e-88
KEGG Definition: hypothetical protein
Accession: fgr:FG05514.1 Score: 798 E_value: 2e-83
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Energy production and conversion].
Kog Number: KOG1192 Score: 157 E_value: 2e-11
PFAM Definition: UDPGT, UDP-glucoronosyl and UDP-glucosyl transferase..
Pfam Number: pfam00201 Score: 115 E_value: 2e-06
Swissprot: Q5KK25|ATG26_CRYNE
Gene Ontology:
GO:0016906 = Molecular function: sterol 3-beta-glucosyltransferase activity

Sequence:
>Contig4118
TTGGGGAACTCGCCGACTTCCTTGACGCAGGACCACCACCAGTCTACATA
GGGTTTGGCTCAATAGTAGTCGACGACCCCGACACACTCACACAGACCAT
CTTCACAGCAGTAAAGTCCACAGGTGTACGTGCCCTAGTCTCAAAAGGCT
GGGGTGGAATCGGCGGCGAAGAATCGGACGTTCCCGACAACTTGTTTATG
CTGGATAATACCCCACACGACTGGCTATTCTCGAGGGTCTCTGCGGTGGT
GCACCATGGCGGAGCAGGGACCACGGCTATTGGACTATACCACGGGAGGC
CGACCATGATCGTACCGTTCTTTGGCGATCAGGCGTTCTGGGGCTCTATG
GTCGCGAACGCCGGCGCGGGCGCGGAGCCGGTCCCGCATAAAGAGCTGAC
GGCGGAGAAGTTGGCGGATGGGATAGAGAAGTTACTGAGCGAGGAGTGCC
AGCTTGCCGCTGGGAAGATAAGTAAGCAGATCCGCGAGGACGATGGGAAC
GGAGCCGAGAACGCCGTAAGGAGTTTTTTCAAGGATGTTGTAGCGCTAGA
GCAGGGGAAGCGGGGACTCGGTGAGTCCGGAAAGGATTGGGGTGAAGGCG
GGCCGGGCGGGCCCGGGGAAGGGAAGTGGGGGCGTGGAGGTCCGGGAATT
CGCTGCTCGTTTCTGGAATATAAGGTTGCTGTTTGGAGAATTCGGAGGAC
GACAGTTAGGCTCAGTGCGCTCGCTGCCTGGTTGCTCGTGCAGGGTGGGA
AGCTCACGTGGAAGGATTTGAGACTCATCCGCCACACAGAATGGAACGAC
TACAATGGCCCCGGTGAGCCCTTCACCGGCGGCATAACTGCGCTCGTTAG
TTCCATCGCTTGTGTGGCTAAAGGAATGGTGACAGTCCCTTACATCTGGT
ACAAGGGTGCCCGCCGCCTTGATTCGGAGGGCCTGGATATTGTCGGTGAG
ATGCGCAGTGGGAGTAAACCCAGCTCCCGCTCCACCACCAGACCCACCCC
GCCAAATCCCGAGACAGAACCACGTCGGTCCACCGATTCCAACGCATGGA
GAACTGACAGTACTTCCAGCTCCCGCTCCCGTTCAAACTCCCCACAAGAC
CCCGTTCCCCT

Sequences in the Contig:

SY0AAC13YN12FM1 SY0AAC25YI13FM1