Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4117
Length(NT) : 816
Best Gene Model Blast : Link to GSTUMT00002450001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_01477
Accession: ref|XP_001792115.1| Score: 1104 E_value: 1e-119
KEGG Definition: glutamate synthase Glt1, putative [EC:1.4.1.13]; K00265 glutamate synthase (NADPH) large chain; K00266 glutamate synthase (NADPH) small chain
Accession: afm:AFUA_1G07380 Score: 1062 E_value: 1e-114
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0399 Score: 1030 E_value: 1e-113
PFAM Definition: Pyr_redox_2, Pyridine nucleotide-disulphide oxidoreductase. This family includes both class I and class II oxidoreductases and also NADH oxidases and peroxidases. This domain is actually a small NADH binding domain within a larger FAD binding domain..
Pfam Number: pfam07992 Score: 117 E_value: 6e-07
Swissprot: Q9C102|GLT1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig4117
TTGGGTAAAAGTCCTTCCCACCGATTACAAGAGAGTTCTGGAAGAGGAAG
CACGAAAATCGAAGGTCTCCCAATACCCATTAGGTCTACTTCCCGGCAAC
CCGGTCCGCGAGCAGCATGAGAAACAGCTGGCAAAGGAGGAGGTAGACAA
GCACAAGCATGTGGCTGCTATGACTGATTTGGAAGACAGTATTTTGGATA
CAAAGGCCGAGAAGAAGTCTGCCTTGGTACTCAACAAGACGAAAGGTTTC
ATGCTCTACTCCCGCCGTCATGAGAAGTATCGGAACTCCAAAACACGTAC
AAAGGATTGGCAAGAACTCAGCAGACGATTGGACGAGGATGAGCTCAAGT
ATCAGTCCGCCCGTTGTATGGACTGCGGTGTCCCCTTCTGCCAGAGCGAT
ACCGGTTGCCCCATCTCGAACATCATCCCCAAGTGGAACGAACTCGTTTT
CCAAAACCAATGGAAGAATGCCCTCTTAAAACTTCTTCAAACCAATCCAT
TTCCCGAGTATACAGGGCGCGTTTGCCCAGCTCCTTGTGAAGGTGCTTGT
GTTCTAGGTATCAACGAGGATCCAGTTGGGATCAAGAACATCGAGTGTGC
AATCATTGACCGTGGTTTTGAGATGGGTTGGATGATTCCTACGCCGCCCG
AAGTTCGCACTGGAAAGAAGGTTGCAATCATTGGCTCCGGTCCTGCTGGT
TTGGCAGCTGCCGATAGTTTGAACAAAGCCGGCCACCTCGTTGTCGTGTA
TGAGAGGGCCGATCGTATTGGTGGTTTGCTAATGTACGGTATTCCGAACA
TGAAGCTCGACAAATC

Sequences in the Contig:

SY0AAC25YI12FM1 SY0AAD38YM03FM1 SY0AAD60YN16FM1