Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4116
Length(NT) : 572
Best Gene Model Blast : Link to GSTUMT00002772001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_500953.1| Score: 188 E_value: 6e-13
KEGG Definition: hypothetical protein
Accession: yli:YALI0B15972g Score: 188 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P80108|PHLD_HUMAN
Gene Ontology:
GO:0004630 = Molecular function: phospholipase D activity

Sequence:
>Contig4116
TTGGGCACCTCGACCCAGGCCTCAGCTCTTAAATGCACCTACTGGACGAG
ATCTGATGTTATCCTGACAGATAATCGAATACAATTTCCTTCTTCTTTAT
CCCTTTTTGTTATTCTCACTCACATACCGTCCGCAATGATGAGAGTGCTG
GCAGGACTATCGCTTCTCGGATTAGCGAGTGCCTGCGGAGTTTTAGTTCA
TAACGAAGTCTTCCAACGTTCCGCAGATGTATTCGCCCTCCCGACCTCGA
ACGAGGATATCTCCACCCACCAGGGAGTCTTCTCTCGACTACTAAAGATC
CACACAGAGTCCGTACAGGCAGGCGCCTTCTTTCCAGACTGGGGCTACCA
ATGTCTCAACACCAACGACGATGCAGAAGCTGCGCACTGGCCGCCCTTCC
TCATCGCTAGCGTCGAGCACATAAACTCTCGATACGGCAGTCTGACCTCC
AAGCAGCGCACGCCGGAAGAGCAGGAGCATCTGGAGAAGCTTATTGGGTT
TGTGTTCGCCGTTGCGAGTCATCAGGTGGCGGATGCGACGTGGCATGCTA
TCCGCCTCCCCACGGCATTTCT

Sequences in the Contig:

SY0AAC25YI09FM1 SY0AAC51YC18FM1