Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4113
Length(NT) : 1400
Best Gene Model Blast : Link to GSTUMT00003674001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001540497.1| Score: 556 E_value: 7e-55
KEGG Definition: hypothetical protein
Accession: ncr:NCU04645.1 Score: 507 E_value: 2e-49
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1676 Score: 204 E_value: 9e-17
PFAM Definition: DUF124, Protein of unknown function DUF124. This prokaryotic protein family has no known function..
Pfam Number: pfam01987 Score: 336 E_value: 5e-32

Sequence:
>Contig4113
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTGCTGTGTCACGTTTCCCC
AAAGAAGAGATGTGCTCGAGTATGAGTGGGTGGGCTGGAAACCAACACCA
AACCACCAAAAAAAAAAGACAGTTAAATATACTCCCCTGAAAGGATAGGC
CTGCATCGGTCTATCATACTCCTACAACAAACTCCCCCTCCCTTGAGCCC
CCTGCTCCACTTGCCGCCGCAGAACAAACTACGGTACTCGTACAAGTACA
TATCTCACATCCCGCCCCTCCTCTCCTTCTTCCTCCTCTCCTTCCTCTTC
CCCCATTTCCTTTTCTTCCCTCGTGCCACTACCCTTCTCCTATACGGTAA
CTTCTCTTCATCCTCTGACCTCTCGTTATCGTAAGTGCTGCCCTCCTGTT
TTTGCTTTTGTTCCTTGTCGAGCAGGGATGTTTGTCAGCTACCCCTCCAC
TATCTTTTTATCCCTGATAACCTCGCAAATCTTCCCGATACCGGTGGGAT
TGGAGAGCAAAGCTTTTCTTCCTACTGACTTCAATCACATTTAGATCCAC
AATCAATCAGAGCAATAATGTCTGCTGGTGCGCCCCCTCCCCCCAATTAC
GCGGGATCTCCTCCCCCGGGAGGAAATTATTACCCTCCTCCCCCAGAAAA
ATCTCCCTACGGACCTGGAGGCCAAGCCCCACAGCAGCAGCAATTCTCTC
CTCCCCCCGGAGCGCCCCAACAACAATACTATCCTCCCCCTCCCCAAAAT
TACCCTCCGCCAGGGCATCCACCTCCACAGCAACAGTCTTTCCCCCCTCC
GCCCCAGCAAGCACAACCCCCTCCCGCACAGCAACAGCAACCTTATGATT
CTAATCGCGCTTCAGTGCCTCCTCAACAAACCGCTTTTGACCCCTCTCGT
GCTGGTCCACCGTCGCAGCCGCAACAGGTTGCCGCTGGTACTAGTGCCGG
TACTATCACGGATACCTTAGGCAGTTTCAATGGTGGAAGCTATAGAATCG
ACCATAGAGACTGCAATACCCTTTTGACCCTTATGCTTGCTCACGGGTGC
CCAGTGACCGCCAAACCCGGCGCCATGGTAGCAATGACTCCAACGGTAAC
GTTGAAAGGCTCCGTCAAGTTCTCCCTGAAGAAAATACTTGCTGGAGGTG
AAATGGCGCAATCAACCTACACTGGCCCTGGGGAATTATTGCTTGCGCCC
GCGGCGTTGGGAGATATTGTCCCTATCCGTTTGGATGGTCAGCAGACTTG
GAGTGTCGGCAAGGATGCCTTCTTGGCTTGTACCCAGGGCGTTGTTAAGG
ACTACAAGAGTCAGGGATTGGGCAAGGCAATGTTCTCCGGCGAGGGATTG
TTCGTTTACAAGATTTCTGGACAGGGAGTTTTGTTCGTGACTAGTTTAGG

Sequences in the Contig:

SY0AAA3YP17FM1 SY0AAA55YA19FM1 SY0AAB27YO01FM1
SY0AAC25YF13FM1 SY0AAD27YK05FM1