Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4111
Length(NT) : 1446
Best Gene Model Blast : Link to GSTUMT00002187001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4111
TTGGCATCAACACAGCTTCCCCGTCATCTCTCATCCCTTGCCTACCACTC
CCTCTCCACTCCACCGTCCCGCGTACGGTATTTTCCTAGAACTTTCCTCC
TTTCCTTCTCTTGCTTAAACAAATCTCCCATCACCAGTACCTTACCTCTC
CTTTTTATCCATAGGCTCTCTCTCACTCTCCTTTCCTCGCCCCATCGCCT
GCCTCCATCTCCCGAGACACCTATCACGAATCACACTTTCTATTGTTACC
CCTTCGCCTCCCTTTCTCAGATTCTTTATCCCCTGATATCCAACAACCTC
GACAGCTTACCGAGACTCTGGCTCCTTCCAGTCTTTGGAACCCGTCAGGG
CTGGTGGCTGAGCCTTTTCACTTCTAACCTTCTCAGCTTCACGAAGCTCC
GGGGGGGGCTGTTTTTTTAAATTTTTTATTTATTTATTACTTCTTTGCTA
TGAGCTCCGTTCTTGTCTCGTGGGGTTTATTCCTCGCAATAGCATTCGCA
GGGTATTGGTGGTATAGTGGGTCGCGTAAAGTTCAGCCTCATGGCAAGCG
CATCATTTTGGCTGCCTCGGAAAAGTTATCTGGTGGCAGTGTCTTTGTGA
GCAGTGGAACGGACGGTAATGCTGCGGAAAAGAAGAAGAAGTCTAAAAAG
AAGAAGGCGGCCCTCTCGAACACTTGCACTAAAAAAGTGGCTTCCATCGA
AGGTGGAGAGAAAGTTGCGCAATCAACCGATGACGATGCGGCGCAAGATG
AAGATGAGCTGCAAGCTTTGCGTAGGCTTCAATCTCTTACAGAGGGTGGT
GGGAAGAAAGGAGCTCTTTCAGGCTCCTCAGCAAACCAGTCTCAATCGCA
GAAGTCTCAATTACAGAAGCCTTACCTCACTACCCCTGCTTCTCCATTTG
CAACAGCTTCTCAGACATCCTCTACCGGCGCTGATGCAGATATTGACGAA
GAGGAGACATCCCAATTGCCCGGGCCTGGGTTCCAACAATCTACTTCTTC
GGATCCTAGTGACATGCTAGAAGAGTCAACCACAGGAGCCCGCATCCTTA
CAATCACACCATCAACACAGCTTCCACGCACACAGAAGCAGAGGTCTACC
ACACCCGCCATCCAAAGTGGAACGCACGCCAACAAAAATGCGAAGAAGAA
GGAGAAGAAGAAGCTAGAAAAGGAAGCAGAGAGAGCTGACCAAAAGGCTA
GATTCGAGCAGCACCGTGCGAGTGTGAGAGCCGCGGAAGTAGCTAAGCAG
AAGAGCAAACTACCTTCTGATGATCCCATGGTTGGTTCTGCGTGGATTAC
CGTCAACGGCAAGAGGTCCTCCACTCCTACCAACGCTCCAGAGGCCAACC
CAGCTTCTGGTGATCTTCTCGACACCTTCGTTTCTCCCGATACCCATGCT
CGCACTCAACACATCTCCGGTGATAGTGAGGAAGACGAGAGCCTTG

Sequences in the Contig:

SY0AAA12YK14FM1 SY0AAB26YB06FM1 SY0AAC25YE11FM1
SY0AAD13YC03FM1 SY0AAD20YM22FM1 SY0AAD49YC10FM1