Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4110
Length(NT) : 3352
Best Gene Model Blast : Link to GSTUMT00004219001 E-value : 0.0
Numbers of ESTs : 66

Blast Results:

Nr Definition: heat shock protein 101
Accession: ref|XP_957228.1| Score: 3133 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ncr:NCU00104.1 Score: 3133 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1051 Score: 2053 E_value: 0.0
PFAM Definition: AAA_2, ATPase family associated with various cellular activities (AAA). This Pfam entry includes some of the AAA proteins not detected by the pfam00004 model..
Pfam Number: pfam07724 Score: 645 E_value: 2e-67
Swissprot: P31540|HSP98_NEUCR

Sequence:
>Contig4110
TTGGCCTCACTCAAAGACTCTCCCTCGATTTCAAGTCTATTTCGTCAGTT
ACCATTGAACTCTTTCGGGAATAATACGGCCTACTCTGCAAACCAAGAGA
CTCCAATACATACGATATAAACACAAATCCTTAATGTCAAATTTACAACT
GACAGACAAGGCTTCCAAAGCTCTATCGGATGCACATGAGTCTGCATCTC
AATATGGACACCCGCAGGTCACTCCTGTACACCTTGTCTGTGCCTTAATA
GATGGACCACAAGTTGAAAATGACACAGCGCCAGCGGGAGCGGCACCAGC
TTCGTCGTCGCCCTCTTTGCTACGTCAGGTTATCGAGAAAGCAAATGGAG
ATTTTCAGACCTTTGAGCGAGCAGTTAAGAAGGCCCGAGTACGGATGCCT
TCGCAAGACCCACCGCCAGACCAAGTTTCATTTTCACCATCCCTTTCTAA
AGTCCTCCGCGATGCTCAGAAATTACAAAAAACCCAACGCGACTCCTATA
TTGCTCAAGATCACCTAATCTCGGCAGTAGCCCAGGACTCCGGAATCCAG
AAACTAATGGTTGAAGCCGGTATCCCAAAGGTTTCCTTGCTCGACGATGC
GGTTCAATCTTTGCGCGGGACCAGGAGAGTGGATTCACAGAATGAGGAGA
GTGTGGAGAGCGAAAATCTTTCAAAATACTGCGTGGATCTCACTCAGCGG
GCTAGAGATGGAAAATTGGATCCCGTCATTGGAAGGGAACAAGAGATTCT
CCGTGTTGTCCGGATCTTGTCCAGACGAACAAAGAATAATCCCGTTCTTA
TTGGTGAGCCTGGAGTTGGTAAGACCAGTGTCGTGGAGGGGTTAGCAACC
AGAATAATCAATGCCGATGTTCCTGCGAATTTGGCTAGCTGCAAGTTACT
CACTCTCGATGTTGGATCCCTCGTCGCAGGAACCAAATATCGCGGAGAAT
TTGAGGATCGTATGAAGGCGGTGTTGAAAGAAATTGAAGATTCTAAGCAA
ATGATTGTACTTTTCATAGATGAGATCCATCTGCTGATGGGAGCTGGAAG
TTCTGGAGAAGGTGGAATGGACGCAGCAAATCTCCTCAAACCCGCACTCG
CTAGAGGCCAACTACATTGTATTGGCGCTACTACACTGGCGGAGTATAGA
AAATACATTGAAAAGGATGCCGCTTTTGAACGCAGATTCCAGCAGGTTTT
ATGCCCGGAGCCGAGTGTCCCCGAAACTATCTCAATTCTTCGAGGTCTCA
AAGAACGTTATGAGGTGCATCACGGTGTGACGATCAGTGACGGAGCTATC
GTTGCTGCTGCTACCCTTGCATCTCGGTACCTCACTGCACGTCGTCTTCC
GGATTCCGCTATCGACTTGATCGACGAGGCTGCATCTGCAGTCCGTGTCA
CCCGAGAATCCGCTCCCGAAATTGTCGACACTCTTGAACGCCGCCATAGA
CAACTCCTGATCGAAATTCATGCTCTTGAGCGTGAAAAAGATGAGGCTTC
TAGGGCAAGGCTCAACGATGCAAAGAGGGAGGCAGCGAACGTGGAAGAGG
AGCTGAAGCCTCTGCGCGAAAAGTACGAGTCCGAGAAGCGTCGGTCAACA
GAGCTTCAGGAAGCGAAGAAGAAGCTTGATGCTCTCACTGCAAAGTGCGA
GCAGGCTGAGCGTGTTGGAAACATCGACATAGCTTCTGATTTGAAGTATT
ATGCTATTCCCGAACTCAAGAAATATATTGCCAAGCTCGAGGCCGAGAAG
CTAGAAGCCGAGCAAGATGCCGCCATTTCATCGGCAAACGGGACTGGAGA
GAACAATCCTATGTTGACCGATTTGGTCGGCCCTGAACAAATCAACGAGA
TTGTGGCCAAATGGACCGGTATCCCGGTGACAAGACTGAAGACTACCGAG
AAGGAGAAGTTGTTGAATATGGAGAAGTACCTATCGAAGCAAGTCATCGG
GCAGCGCGAGGCTGTCAAAGCGGTAGCCAATGCCATTCGATTGAGCCGAA
GCGGTCTCAGCAACCCCAACCAACCTATCGCTAGTTTCTTGTTTTGTGGA
CCTTCTGGGACTGGTAAAACTTTGTTGACGAAGAGTTTGGCCGAGTTCTT
ATTCGATGATCCTAAGAGCATGATCCGCTTTGATATGTCCGAGTACATGG
AGAAGCACAGTGTATCCAGGCTTATCGGTGCTCCACCTGGATATATTGGA
CACGATTCTGGTGGTCAACTCACCGAGGCTCTTCGCCGACGCCCATTCTC
TATCCTCCTCTTTGACGAAATTGAGAAGGCAGCAAAGGAGGTCCTCACCG
TACTTCTACAACTCCTCGACGATGGGCGCATCACAGATTCCACTGGCAGA
ATTGTGGACGGCAAAAACACCGTAATCATTATGACGAGCAACCTCGGATC
CCAATACATTTCCTCTCATTCCCACTCAGAAGACGGCAGGATAGACCCAA
CGACGAGGGAACTCGTAAATGAAGCGATTAGGCAGCATTTCCTCCCTGAG
TTCATCAACCGCATATCCAGTATCGTCATATTCAACCGCCTCGCAAAGAG
GGAGATCCGTAAGATTGTCGACCTCAGATTAGTTGATATCCAGAAGCGTC
TGCGAAGCAACAACCGCAATGTCATCCTCCTCGTCGACGAGCAGGCAAGG
GACTACTTGGGCGAAGCTGGATACTCTCCCAGTTATGGTGCCCGCCCACT
GAACAGAGTCATCGAGAAGGAGATCCTCAACAAGCTTGCCGTCTTATTGC
TGAGAGGTGCCATCAGGGAGGGGGAAGTCGCACACATCACTATGGACGAG
ACTGGACATCGGATTGTCGTTCTACCGAATCACGATAGTGATATCGAAGA
AGACGAGGATATGGACTATATCGAGGAGGATGCGCAAGGCATGGGTGGTG
AAGATCCGGACATTGAGCTGTATGGATAAGCTCATTTTTATTTTTTTCAT
GTAAATTAGATGGGTTTCTCATGCTGCTTTTTCCTTTTACTAGTATCATA
CTTTGTAATTCCTGTTGTCTAACGCCCCCTGTTTCGAGAAAAAAAAGTCA
TGTTTTCCTCTCTTCTGTTGCACCTCCTCTCTTTCAACATTTTGTTCGTC
TTTTCTAAGGTGGGTCTCGTAAAAAATTTTGTTTATTCCTGAGCTCTTTT
TTCCTATCCCTCCCCAGGGTACCTAATTTTATTGTTGGTGTTGTCGCTGA
GATTATTGACATACCTACATATCTGTGGTAGAAAAATGGAAACTTGAAGA
TTGTCATATTTGGTTACTTGTAGTTAGTTACGGGTAACTTTGCCAATCCA
GAGGAGAATTCCATTTTATTCTAGTCCAATTTAAAAGCATCATTGTCAAA
CA

Sequences in the Contig:

SY0AAA10YN11FM1 SY0AAA13YL05FM1 SY0AAA16YE05FM1
SY0AAA21YD08FM1 SY0AAA24YN21FM1 SY0AAA24YN21FM2
SY0AAA24YN21RM1 SY0AAA25YJ14FM1 SY0AAA25YJ14RM1
SY0AAA26YJ14FM1 SY0AAA28YG11FM1 SY0AAA28YP02FM1
SY0AAA29YN10FM1 SY0AAA31YI14FM1 SY0AAA31YI14RM1
SY0AAA36YD21FM1 SY0AAA38YO24FM1 SY0AAA40YE24FM1
SY0AAA44YF14FM1 SY0AAA47YE08FM1 SY0AAA47YE15FM1
SY0AAA50YI16FM1 SY0AAA54YC01FM1 SY0AAA58YE02FM1
SY0AAA61YO02FM1 SY0AAA9YC22FM1 SY0AAB13YJ19FM1
SY0AAB17YJ07FM1 SY0AAB18YC13FM1 SY0AAB19YB13FM1
SY0AAB19YP06FM1 SY0AAB23YE18FM1 SY0AAB26YC16FM1
SY0AAB28YD15FM1 SY0AAB30YN10FM1 SY0AAB33YB10FM1
SY0AAB33YM07FM1 SY0AAB36YD09FM1 SY0AAB36YL22FM1
SY0AAB37YA10FM1 SY0AAB37YE07FM1 SY0AAB39YF03FM1
SY0AAB41YN21FM1 SY0AAB42YH13FM1 SY0AAB44YA06FM1
SY0AAB47YA05FM1 SY0AAB48YD10FM1 SY0AAB49YD10FM1
SY0AAB58YE04FM1 SY0AAB59YO03FM1 SY0AAB6YP24FM1
SY0AAC21YK09FM1 SY0AAC25YD20FM1 SY0AAC27YO15FM1
SY0AAC34YF07FM1 SY0AAC35YF18FM1 SY0AAC35YK04FM1
SY0AAC4YP13FM1 SY0AAC58YN18FM1 SY0AAD24YI04FM1
SY0AAD2YG16FM1 SY0AAD35YA21FM1 SY0AAD43YG04FM1
SY0AAD43YP12FM1 SY0AAD57YI15FM1 SY0AAD9YJ07FM1