Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig411
Length(NT) : 648
Best Gene Model Blast : Link to GSTUMT00005771001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig411
TTGGATTGGATACCTGCTGTGCCGGTAGAAAAAAGGAAGGGAAAGAGAAA
AGAGTTCTGCCTATCATTACCATGGCTGGTTCTACTATTGCTAGGTATGT
ACAGTACTTTGTCCTGCATTGTTCTACTGCGATGTTCTGCATCTGCGTCA
TGTACACTCTCGTACTGCTGTACAGCGCAGCGGGAGCGCAAGCTCACATT
GCTTGACAGTTTCCTAACGGCCCCGACAATCCGGCTCATTCTCCCCACCG
GCGACTCCGGGGAGGAGGACCTTACGTACTCCGTCCACCGCCCGCTCCTG
GCAAAGTATACTTCGCTCTTACAATCGCGTAAGCCCCGCGACTCGTATGT
CCTCCTCGACCCGTCGAGCGTGAGCGTTCCCACACTCGATCATGCGCTAG
AATTTTTGTACACGGGGGATTACGTGCTCCCCGGTGAGCCGGGAGAGGAG
GAAGAAGCTGATGACCAACCGTTGCTGCATTCCACTCGGCCAGCGGCGCA
TCTCCCCCGCTCCCCGCTCATGTACGCCGCTATGGCGGGTGCTATAGGCG
TGTGGGGTAAGCCCGCGCCGGTGTTTGAAAAAGCGGACAACACATCGACC
TACACGTCGGAGTACTTTCCCGAGCAGAAAAACGGGGAGAAGAAGACC

Sequences in the Contig:

SY0AAA23YD08FM1 SY0AAA49YB19FM1 SY0AAB35YP20FM1
SY0AAB41YF22FM1 SY0AAB49YO11FM1 SY0AAD62YG22FM1