Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4109
Length(NT) : 1643
Best Gene Model Blast : Link to GSTUMT00006579001 E-value : 0.0
Numbers of ESTs : 35

Blast Results:

Nr Definition: DUF1479 domain protein
Accession: ref|XP_001274128.1| Score: 1070 E_value: 1e-114
KEGG Definition: hypothetical protein
Accession: ang:An07g03730 Score: 1029 E_value: 1e-110
KOG Definition: No Hit Found
PFAM Definition: DUF1479, Protein of unknown function (DUF1479). This family consists of several hypothetical Enterobacterial proteins, of around 420 residues in length. Members of this family are often known as YbiU. The function of this family is unknown..
Pfam Number: pfam07350 Score: 525 E_value: 7e-54
Swissprot: P75791|YBIU_ECOLI

Sequence:
>Contig4109
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTCTATCATACCACGACAA
ACTCTATCTTGAGCGGAAATAAAAAAACTCTATCTTGAGCGGAAATAAAA
AAAACTCTATCTTGAGGGGAAATAAAACAAACTCTATCTTGAGCGGAAAG
AAAACAAAATGTTATCGAGGGCAAAACTCCTCGCGCCCAAGTTGGCACTT
GCCACCCGTCGGGTGGCTACGACTACCGCACCAAAGAGTAAAGTCGGCGG
AGACATTTCTTCAGTCTTTCCCTCACTCTCAGGGATCGCACCGCCCCCGT
TACCGGATAGGTATGCTGACCTTAAAAGGCGGTTTATATCTGGACGGGAG
AGGATCCTGTCAGAGTCCTGGGAGAGGTTATTGCTTGACCTTGAGAAGGA
GACGGCGGCGGTGAAGAAGTTTGGGAGTGATATTATCCCAAAAGTCGATT
TCAAAGAACTTGCTAGTCTCTCCAAAGAGAAGATAGAGGAGATTAAGAAA
CGAGGTGTGGTCGTTATTAAGAATGTCCTGCAGGACCAGCAAGCTCTGGC
CATGAAGGACTCTTTAAAAGAGCACATCAAGCGCAACCCCTGGGCAGCAG
CTTTCCCCGCTAACTCACCGGCGGTCTACGAGCTATACTGGTCTCCAGCC
CAGCGCGCCGCGAGATCCCATCCATCACTCGTGGCCTCCCAGCGTTTTGT
AAACTCTCTCTGGCATTCTTCTCTCCCGTCATCGGTGGTGGACACCTCCG
TGTGTCTGCCTTACGCTGACCGCTTTCGTATTCGCCAGCCTGGTGATGCA
GGCTTTGCTCTTGGGGCGCACATAGACGGAGGTAGTGTGGAGCGCTGGGA
AGATCCAGAGTATTGTCGCTGCTATGAGAAGATCTGGACTGGGCAATGGG
AGGAGTATGATGCGTATAAAGCGGATCACAGGGTCCATGCAAAGATGGAT
ATGTACGACGGAGCGGGCAGTTGTGGAGTCTGGAGGAGTTGGCAGGGCTG
GCTCTCCTTATCAACTACATCCCCCGGCGAGGGCACCCTCCTGGTAAACC
CTCTGCTAAAACACTCAACAGCATACACAATCCTGCGTCCATTCTTTACC
CTCTCCAATCCCCCAACTCTGAGCACAACTCCCCACTTCCCAAACTCTGT
CCAGGGTGCGTGTCAGGAATACAGCAATTCAACACATCCCCACCTCCGCC
TCGACGACGCAATGACGCACGTGCCCCGCATCTCGCCGGGCGACTACGTC
TTCTGGCACTGTGATACCATTCACGCCGTGGATCGCGTGCATCAGGGGGC
AAGTGATAGCTCTGTGCTGTACATTCCGGCTGTGCCGTGGACAGTGGAGA
ATCAAGCTTATGTCGAGCGGCAGAGAGAAGCCGAGAGGAGGGGGGTGTCA
CCAGAGGATTTCCCGGTGGGGCTTGGAGTGGAGGTTTGAGGGTGATGTTG
GTGATATTTTCTTCTTCCTTGTCTCTCACTCGCTCGCAAGAGAGCGGGTC
ATAGGTGGCAGGATGTTTCAATTATAGTACTCTAGTACTCCGTTCAAGCA
CCATTTCGTCAAAATCATACCCTCCCTTTCTTTCCTTTTTTCTTTCATGT
TTGCCGGTTCAGTTATTCCATTTTAATACTTTTCTTTAAATGT

Sequences in the Contig:

SY0AAC13YG13FM1 SY0AAC14YP23FM1 SY0AAC15YH11FM1
SY0AAC25YD04FM1 SY0AAC2YL24FM1 SY0AAC33YC15FM1
SY0AAC34YM19FM1 SY0AAC36YF16FM1 SY0AAC37YK10FM1
SY0AAC39YF07FM1 SY0AAC42YK20FM1 SY0AAC43YM14FM1
SY0AAC48YM02FM1 SY0AAC51YB02FM1 SY0AAC52YD19FM1
SY0AAC57YJ02FM1 SY0AAC59YB02FM1 SY0AAC6YL01FM1
SY0AAC9YA24FM1 SY0AAD13YD12FM1 SY0AAD21YI16FM1
SY0AAD23YA21FM1 SY0AAD24YN15FM1 SY0AAD25YF10FM1
SY0AAD27YL13FM1 SY0AAD30YC21FM1 SY0AAD34YP12FM1
SY0AAD40YP16FM1 SY0AAD46YC09FM1 SY0AAD52YF18FM1
SY0AAD56YA15FM1 SY0AAD57YN18FM1 SY0AAD57YP13FM1
SY0AAD58YD10FM1 SY0AAD63YI18FM1