Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4107
Length(NT) : 692
Best Gene Model Blast : Link to GSTUMT00009297001 E-value : 1e-127
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_15497
Accession: ref|XP_001805643.1| Score: 207 E_value: 6e-15
KEGG Definition: hypothetical protein
Accession: ani:AN8169.2 Score: 200 E_value: 2e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4107
CGGATGAAATACTAACTTTATTGTTTTCCTCTAAAAATTCCCAGATTATG
AAAGTCTATCTACATTATTTCAGAGCAGAGCAAGGGAAAAGGAAAGAAGT
GCCATCGTTTGGCTCGGTATACGCACGCACCTTGATGGTGCCCTCTGACC
TGCTACCCTTGTCATCAACAGCGGGGTAAGGTGCATGTTACCGGGTATAA
TACCTTGTTAGGCACCTGCAAGCTCCCAACACCTCAGTTTGGTAATTTTG
GTAAACTCATTCGGTCTACTTTCTTGATCCCATTTGAGGGTTTTGAGCTT
CAATTTAGCATGTTCCACCTCCTCGGTGTGTAGGTGTGCCCCGCTCTCCC
TTAGTAACGAGACGTTGACTTCAATACCGGCATCGGCCGCCAGAAATAGG
GGTGTTCTGCCATCACCGTTACGCAAATGAACCGAAGCTCCTTGAGAGAG
AAAATCACGGAGTATGTCAATATTACGGCACGTGGAGGCCAGGTGCTAAT
CGAACGCTGTTCGTTAGAAAGAGAGGGGAAAAAAGTGGAATGCAAGGTTA
GGCAAAGAACGGTAACAATATCCTTCCCGGGTGAGAGGCGCTGGAGTTAT
GTAATAGTGGACCGGAGGGCACAAGTGATGGCATAGATCGTGAAAAGGTT
GTCGTAAAAGCGAAAGGGGAAAGTACATAGGTAGCGTCCCAA

Sequences in the Contig:

SY0AAC19YF23RM1 SY0AAC25YC08RM1 SY0AAC26YA12RM1
SY0AAC27YD21RM1 SY0AAC27YE02RM1 SY0AAC58YN14FM1