Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4106
Length(NT) : 1175
Best Gene Model Blast : Link to GSTUMT00002176001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein AN3683.2
Accession: ref|XP_661287.1| Score: 581 E_value: 6e-58
KEGG Definition: hypothetical protein
Accession: ani:AN3683.2 Score: 581 E_value: 3e-58
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P49413|UAY_EMENI

Sequence:
>Contig4106
TTGGGGAGTATGTGATGCCTGTCATGATTACACTTTTCTTTTTTCTCCCG
GAGCCCCAACGTTTCAAGCTGCCATGAGGGTATTGCAAACTAACTCATCG
GTAGATATGGGCTTTCCCATGTACTAGGCCGGCCATCAGCATTTGCAACC
GCAGACGCCTTTGTGGACGTTGGATTTTATGAACCAGTCGATGATGTGTA
CATAACAGCTGGTGGAATCCTACCAGGTCCCGTTTCTGTTAAAAAACTGA
TATCCATGCATTTCTTCCGTATGAGGAGGCTACAGGCCGAGATTCGACAA
ACATTATATCAAAACCCAAGGGAACACCCGAAAAATAACAGCGACCCTTG
GTTTGCTCAAATTCATGCGAAACTTGACAACTGGAGAGCCTCTTGTCCTG
TAGATGAACACGGTGGTACTATGAATCCAGACTGGTAGGTCTCTTTTGGC
GTACTTTTAAAATCTATACTAATATCAGTACGTAGGTTTGATCATAGATA
CCATCTTATGATCATCTTCACCTATCGCCCAAGCCCTCAGATACCCCAAC
CCTCAGCAGAGGCGGTCTCGCACTGTTATAACTCCGCCATAAAGGGAATT
CATCTCCAAAAGAAAATGTTTGAAGAAAAGTCAATCGACTTCACCTGGGT
CTACCTTCATCAGATCTACACTGCGACTATCACCCTGATCTGGACTCTGT
ACAGCAGCCAGATTCGTGGAGTGCACCATCGGGAGGAAGTGGAGCGTAAT
CTGGGGATCAGTCTTTCCTTGTTAGCTAGGCTCGCAGAACGTTGGCCGGG
CACAGAAGCAGCGGCAGACCTATTTGACAGACTAGGTCAGGCGGCCTTGC
AGAGCTATTCCGGGAATAGTAGACACTCTACTCAATCACCCTCCACCGGG
TCGCATCACTCCCACGCCGGATCTCCGCCAGCAACGAGGACTAGTTTCTC
CCCCCATAGCCATTCCTCCCCATGCACGTACGAGAGTTCGTCTGGCTCAC
GCTCGGTGGAAATGACACCTAGTCCTGGAACATCTGGAACGGCTACTTCT
CATGGTGCCTCATATTCCACTGGGTTTCGTTCTACCGATTACGAGAATGA
GCAGAACCGTAGTCCCCCAGGCCCAGAGTTGCCCGAAGCCGCAGATTTGC
CAAGCATATTCGATCCGGCCTCAAT

Sequences in the Contig:

SY0AAC25YC03FM1 SY0AAC28YK21FM1 SY0AAC41YL09FM1
SY0AAC4YH09FM1 SY0AAD8YG07FM1