Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4104
Length(NT) : 1654
Best Gene Model Blast : Link to GSTUMT00011894001 E-value : 1e-161
Numbers of ESTs : 62

Blast Results:

Nr Definition: HS30_EMENI 30 KD HEAT SHOCK PROTEIN
Accession: ref|XP_661159.1| Score: 289 E_value: 7e-24
KEGG Definition: 30 kD heat shock protein
Accession: ani:AN3555.2 Score: 289 E_value: 4e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P40920|HSP30_EMENI

Sequence:
>Contig4104
TTCACGGCGTCCATATCCACATAACTCGGGAACGAGAAGCTGCGTTGGAA
CTCGCCGACCGTGCGCTCCGAAACCCAATAGCGGGGCCTGGAATCTTTAT
CCTTCTCCTCGATGGCACCCTTGGCTTCTTGCTGGACCTCTTTTTTGTCT
TTCTTGGCGATGGCGGGTTCGTTGTCCGAGGACTCCTGGTGAAGGCGTTC
GGTCTTGCCGCGGACGAGGAGTGTCTGGGGGTCGGTGAACTCGATGCTTA
GGTTCGACTTATCGTGGAGTCCTGGGAGTTCGCCTTCGAGGACGTAGGCT
TGTTCCGTTTCGTGAACGTCGAAGCTTGGGGAGAAGGCACCACGGCGGTT
GGTGCGTTGGGGTATGCGAGAGGTATCGTCAAGGAGACTGAAGATATCAG
AGTATTGCCTTAGAAGCGACATTTTGTCCTCGTTTTTGTGGTTTGTCGAA
GTATGCTTTTTGAAATGGTGTTTGGGAGATTTTGGGGGGACAACTTTGTA
CAAAAAAGTTGGGGGGACAACTTTGTACAAAAAAGTTGGGATACTTCCGT
CTTCCTTCGCTTCATCTCCTATCACTGTGTTCAGTCATTCGTTTCTTAAA
TCTCCGATCTTATTTCTATTGTCCTTCTTCATAAAAGCCGTCTATCGTTA
TATTTGTCCATACCAAATAAAAGCCCTGTGTGATTCGGTTACCAAGGATT
AGATCCGCTGTGCCCCACTACCCTTTTAGTTGTTCAAAACGCTTGCACTC
CGGGAAACCGCAGTGATGGCGATGCCAGTGAGCTGCCCGCACATGACCAG
AACCTGGGTAGTTCTGAAACTCTCGTCTTGCCGGTCATCACTCACATTAC
CAACCCGCTTTGCGTTTGGTTGCGATCATGGTTGCGTCGAGAAAACCTAT
TCTATGGTTCAGGTCACGATAAATCTACACATCCGGCGATTGTTCAGCCT
GCTCTGGAGCGGGAAGAGCTCACCGCCGAATCACGGGATGGTTGTGGCGG
GACATCACACCCGTGCGTCGGTGATCTTCACAGCGAGTGAGTAGAGAAGC
TGTTTCTGGAAGCGGCTAGTTATCTACCTATACCGCCGGATACCTATCCA
ATATCAAAACACTACCATGGTCTGAATACCGCCTCGCAAAACCTTCACTA
CGGTAGAAAACTACCTACCGGGAATGATCTATCCGGCAACCCCACAGGAA
AATGGCGGCCAACACGCGCCATCACTGTCGCCGCCCCAAAACTCCGAGGA
CCCTTGCACAAGAGGAACCGGTAGGGGCAAATCCCGCCAGGTCCATCACT
TCTTGGCCCTCTTCTTCGTCCTTCCCCGCGTCACAGGCCCGGAGGCAGGG
ACAGGAGATGCAACCCGAATCGCGGGAAGGTCCGGCGAGGGTTCACAGCC
GTAGGGAGGCGGCGGCTCGGGGGCATCAACGACCGCAGAGGCCGGAGAAA
AAAACAACACCCGAGAAGATTACCAATGCGGCTACAGGGCCGCAGGGAAA
GTCGACCCGTTACAGATATCCGCCCGCCACCCGCCCAGTCCCATCTAGCG
TTGTTACCTGGACGCCTACACTTTCTTTAGCATATGTTTAGTTTATACGA
GTGCGGCCGATAAATATATTCGTCACGTGCCTTATCTAAGGACACATCGT
AGCC

Sequences in the Contig:

SY0AAC11YM12FM1 SY0AAC14YM19FM1 SY0AAC15YD18FM1
SY0AAC16YG07FM1 SY0AAC17YJ04FM1 SY0AAC18YG22FM1
SY0AAC20YI19FM1 SY0AAC20YI19RM1 SY0AAC25YA15FM1
SY0AAC28YE12FM1 SY0AAC28YE12RM1 SY0AAC2YC23FM1
SY0AAC31YG11FM1 SY0AAC31YG11RM1 SY0AAC32YA21FM1
SY0AAC38YN04FM1 SY0AAC39YM16FM1 SY0AAC39YM23FM1
SY0AAC3YA23FM1 SY0AAC45YC17FM1 SY0AAC45YE13FM1
SY0AAC49YC04FM1 SY0AAC4YG05FM1 SY0AAC4YO14FM1
SY0AAC53YI03FM1 SY0AAC56YE05FM1 SY0AAC58YB09FM1
SY0AAC59YI23FM1 SY0AAC61YH02FM1 SY0AAC62YN24FM1
SY0AAD11YH02FM1 SY0AAD12YO12FM1 SY0AAD17YO22FM1
SY0AAD18YH11FM1 SY0AAD18YL23FM1 SY0AAD19YI01FM1
SY0AAD20YD15FM1 SY0AAD24YI14FM1 SY0AAD32YM17FM1
SY0AAD33YD11FM1 SY0AAD36YD08FM1 SY0AAD41YP01FM1
SY0AAD45YA03FM1 SY0AAD45YC07FM1 SY0AAD46YG24FM1
SY0AAD46YP22FM1 SY0AAD47YB10FM1 SY0AAD50YG19FM1
SY0AAD50YI18FM1 SY0AAD51YH03FM1 SY0AAD52YI23FM1
SY0AAD53YI01FM1 SY0AAD53YN22FM1 SY0AAD55YC11FM1
SY0AAD56YN10FM1 SY0AAD58YI05FM1 SY0AAD62YK12FM1
SY0AAD62YM01FM1 SY0AAD63YM09FM1 SY0AAD8YC24FM1
SY0AAD9YG21FM1 SY0AAD9YN18FM1