Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4103
Length(NT) : 923
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4103
TTGGGGCGGCAGTGAAATAGGATGTTTTCTGCGTTTCCCTTTTGTCTTCC
GGTATCTTTTTCCATTTTTTCCACTTCTTTTCCTAGCTAGGTTTTCCTTT
TGACTCTAATGCGGATGGGTTTTTGGGGCATGGAACAGTGGAAAATGTCT
TTTCAACTTTTATAATCTTGAGCACAAACGGGTGATTTCTTGCACTGGGT
TGGCGGCCGATCTGAACAGGGGATTTGATCAGATGAAGGAACTTGGGGGG
GAGGAGGAAGTTGTTGATATATAGCTATCAGCTTCCTAATCGGGGCTTTG
TGCGGCGATTCCATAGCACTGGCTTTGTGCAGACGTGCCATTTCACGGGC
CAAATTATTGGCTAGAGGCCCGCTTATCAAACACCTCTCTCCGCCACTCA
CACCCGGTGGTAGTGTCAAGCCCACGGTCACGTTGGCTAGGCAGTCCAAT
GCCCCTTACGAGAGCCGGACTCGCCTCAAACGAGCGACCTTGACAACATG
ATTCGTACCCATCGTCCCGTTTCCGCTTTTCATACAGTTGCCTGCGGGCA
GGGGACGGAGACGCCATCAGCTTGGAATGTATGGCACTATCAGATTCATT
ATATTCTATGTACTGTTACTAGTACAACAATTTTCTCTACGAAATGAGTA
CCCAGTCTAGCGCGCATCTACAAACGGTGGGAGCCCTTTCATCCCTTCCG
TTAGCACAGGGGTGCAAGGGAGAGAGACATGCGGGGAGGAGAATAGATGT
GTGGCGATCGATGGATTGGAGGATGACCTCCATTATGTTTCTACGGTATA
CTCCTTTCTTACCTACTGGTAGTTGTTATTTAGTGTCATCGCATGAATGC
GCTGGCTAGGTTGACCGGGACAGAATGATACCCCCCCCTCGTCTCACTTA
CCCTTAGACCCCCGTACTTCGGG

Sequences in the Contig:

SY0AAC17YA16FM1 SY0AAC25YA09FM1 SY0AAC8YA13FM1