Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4100
Length(NT) : 2443
Best Gene Model Blast : Link to GSTUMT00002470001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: hypothetical protein CIMG_02550
Accession: ref|XP_001248779.1| Score: 2630 E_value: 0.0
KEGG Definition: pmtA; protein O-mannosyl transferase pmtA-Aspergillus niger [EC:2.4.1.109]; K00728 dolichyl-phosphate-mannose-protein mannosyltransferase
Accession: ang:An07g10350 Score: 2577 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3359 Score: 2069 E_value: 0.0
PFAM Definition: PMT, Dolichyl-phosphate-mannose-protein mannosyltransferase. This is a family of Dolichyl-phosphate-mannose-protein mannosyltransferase proteins EC:2.4.1.109. These proteins are responsible for O-linked glycosylation of proteins, they catalyse the reaction:- Dolichyl phosphate D-mannose + protein <=> dolichyl phosphate + O-D-mannosyl-protein. Also in this family is Drosophila rotated abdomen protein which is a putative mannosyltransferase. This family appears to be distantly related to pfam02516 (A Bateman pers. obs.)..
Pfam Number: pfam02366 Score: 704 E_value: 2e-74
Swissprot: P31382|PMT2_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0004169 = Molecular function: dolichyl-phosphate-mannose-protein mannosyltransferase activity
GO:0042802 = Molecular function: identical protein binding
GO:0006493 = Biological process: protein amino acid O-linked glycosylation

Sequence:
>Contig4100
TTGGGCCGCGCTCCCCATCCCTCGCTTCTTTCGACTGGAAAAACTTCCCG
TCTTCACCTCCCCTGCTTTTGTCTGCCGGCGCGATACATGATTGCTGTGT
ACTCGTCTTCGTGGTTCCATTTCTTCATTCTTTGACACCTAATACCCTCC
CTTTCTCTCTCCATCTCCTTTGACATCCGGGTCCCCCAAACCCTGCTCAT
TCGAAAGCCTACCTGCCCATCTATTAATTCTCTCACTTTCCCTTCCGTGC
TATTGTTTTCATTGAATTTCGGAACTTCGATTTCAGCCTCCCTTTTTTTC
CTCTTTCTGTTGCGGAACAACTTCGTCTTTGATATAGGGTTTACCTTTTG
CCCGGCGTCTAGGCTATGGCGTCGAAAAACGGTGCGGCCTCCTACGGCAC
AGGTGCTGAGTTGGATGCTGCCGGGACGAGGAGAAGAAACGTACCTGGTG
GATCACTAGTCGGAGGCGATATCGTTGTGCCAGCACTGGAGGATACTAAG
AAACAGCAGAAGATTGATCAAGCTGGTGATGTGGACATCGAGGCTATAGT
AGCTCCGATATTCTTCACACTCTTGTCCTTCTTCACGAGGCTATACAAGA
TCGGGCAGTCTAATATCGTTACATGGGATGAAGCACACTTTGGAAAATTT
GGATCTCATTACCTTAAGCGCGAATTCTACTTCGATGTGCATCCTCCGCT
TGGAAAGATGCTTGTGGGTCTCTCGGGTTGGATGGCCGGGTATAATGGCT
CTTTTGAGTTCAAGTCTGGAGAAGTTTACCCGGAAGGACTTAACTATACC
TTCATGAGAGTCTTCAATGCTACCTTCGGAGCTCTGTGTGTTCCTCTTGC
CTACTTTACCGCCAAGGAATTGAAACTTTCGAAGCCTGCGGTATGGCTGG
TGACTCTGATGGTTTTGTGTGAGAACTCGTATGCTACCATCAGCAGGTTT
ATCTTGCTCGATTCTATGCTTCTGTTCTTTACCTTCACTACTATGCTTTG
CTTCGCACGGTTCCACAGACTCCAAACCAAGTCTTTCTCGCCCCAGTGGT
GGCTGTGGCTGGTTCTTAGCGGACTCTCAATCGGTTGTGTCTGCAGTGTT
AAATGGGTTGGACTGTTTGTTACCGGAGTTGTTGGCCTTTACACTATCGA
GGACTTGTGGAACAAGTTCGGAGATCTTAAGATGCCCAAGATTGTATATG
CACAACATTGGGTCGCTCGCATTATTGGCCTTATTGTGATCCCTATGGTT
GTTTACATGTGGAGTTTCTGGATGCACTTCGCTATCCTCGAGAATTCTGG
CCCCGGAGATGCCCAGATGAGCTCTCTGTTCCAGGCTAACCTCAAAGGGA
CGGACCTTACCGATAGTCCGTTGGAAATCGCTCTTGGCTCACGTGCCACT
ATCAAGAACATGGGTTATGGCGGTGGTCTTTTGCATTCCCATGTTCAAAC
GTACCCTGAAGGATCCGGCCAGCAACAGGTTACTTGCTATCATCACAAGG
ATGCCAACAACGATTGGTACTTCCACCCCAACCGTGGCCAGCCTGATTTT
GATACAGAGTCACCAGATCTCCATTTTGTTGGAAATGGGGATGTCATCCG
TCTTATCCATGCCCAAACCGGTCGTAACTTGCATTCTCACGCCGTCGCTG
CTCCCCTTACCAAGGCCGATTTTGAGGTCTCATCCTACGGAAATCTGACA
GTTGGTGACGAAAAGGACCACTGGACTATCGAGGTTGTGAGTGATGCTGC
TGGGAGAGATTACAGCAAACTCAGAACCCTCACTGCTGCGTTCCGATTGA
GACACACTAGCTTGGGCTGCTACCTCAGAGCTGGAAATGTCAATCTGCCT
CAGTGGGGTTTCAAGCAGATTGAGGTTACTTGTACCAAGAAGAATAACCC
AAGGGATGTTTTTACCCACTGGAACGTCGAGAGCCATTGGAATGAAAAGC
TTCCAAATGCGGATGTCAAGGCATTCAGATCGCCGTTTCTTCGTGATTTC
ATTCACTTGAATGTTGCTATGATGACCTCCAACAACGCTTTGGTTCCAGA
TCCCGACAAGCAAGACGACCTGGCATCTGCTTACTGGCAATGGCCGATTC
TTCACGTTGGGTTGAGGATGTGCAGCTGGGATGATGGTATCGTTAAATAC
TTCCTTTTGGGAAACCCTATGGTGTACTGGGGATCGACTCTGGCACTCCC
CCTATTCTCACTTTTGGTCCTTTTATACCTCATCCGGTGGCAGCGTGGAT
ATAACGATCTGGATGGCGAGGGAATTGATCACATTCGCGCCGCAGGAATA
TACCCTCTTATCGGTTGGGTCTTCCACTATGTTCCTTTTATCGCCATGGC
GAGAGTAACATATGTTCATCATTACTACCCTGCTCTTTATTTTGCGATCT
TGGTATTTGGGTTTCTTTTTAATCATCTCACCAATAAGTTGCC

Sequences in the Contig:

SY0AAA11YA10FM1 SY0AAA30YI02FM1 SY0AAA42YF04FM1
SY0AAA46YP11FM1 SY0AAA54YG18FM1 SY0AAA63YD15FM1
SY0AAA8YK03FM1 SY0AAB20YO23FM1 SY0AAB22YH08FM1
SY0AAB35YM24FM1 SY0AAB57YF05FM1 SY0AAB57YF09FM1
SY0AAC24YN15FM1 SY0AAC48YO13FM1 SY0AAD36YL23FM1