Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig410
Length(NT) : 1176
Best Gene Model Blast : Link to GSTUMT00009757001 E-value : 0.0
Numbers of ESTs : 35

Blast Results:

Nr Definition: hypothetical protein SS1G_06287
Accession: ref|XP_001593365.1| Score: 918 E_value: 5e-97
KEGG Definition: predicted NAD-dependent oxidoreductase; K07119
Accession: aor:AO090005001147 Score: 852 E_value: 1e-89
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1196 Score: 829 E_value: 2e-89
PFAM Definition: ADH_zinc_N, Zinc-binding dehydrogenase..
Pfam Number: pfam00107 Score: 186 E_value: 9e-15
Swissprot: Q39173|P2_ARATH
Gene Ontology:
GO:0032440 = Molecular function: 2-alkenal reductase activity

Sequence:
>Contig410
TTGGTACAGATTGACGACACCTCACTCGAGCAGAGTGCTCGAGCATAATA
CTGTCTGAAGAGTTATAAAAGCTCAAGTCTGCTCTCGTCCTCGGGGGGTT
TTTATTATTATTTATTTTGTTCTAGAACATCAGATTTGGCATCATCAAAA
GCTACACAGCACTTTGAAGATCCATACTTACATCAATCCAATACGGTATC
ATACCTGGATAAAGAAAGCCCCCACACACACGCGTATACGTCCCTCCTCC
ATTGAAAACACCAAAATGGTCTCCAACAAACGTGTCGTTTTCAACTCAAT
CCCCAGTGGCTTCCCCGTTGCGGGAAAGGACCTCATCCTCGACACTGTCG
AAGTTGATCTCGACAATGTCCCGCAGGGCGGTGTCATCACCAAGAATTTT
TATCTCTCCTTCGACCCGTACCAGCGTGGACGTATGCGCGCCCCAGACGT
CGTATCATACTCCCCGCCATTTGCCCTCCATCAGGCCATCACGAACGACG
GTATTAGTCAGATTGTCAGGAGTGACAACCCGAATTTCAAGGAAGGCGAA
TTGTGCAGCGGACAGACCGGTACCGAGGAGTACACCGTACACACTGAGAA
TACGGCGAAGGGATTGAAGAAGATCCACAACCCGTACAATCTCCCCCTGA
GCTACTTCACCGGTGTATTGGGAATGCCCGGATTGACTGCTTATTCCTCC
CTCTACGAGATCGGGAAGCCAAAGAAGGGTGAGACAATCTTCGTCTCGGC
AGCCTCGGGCGCCGTGGGGTCCATTGTTGGTCAACTCGCGAAGCGGGAGG
GCCTCCGGGTAATCGGCTCGGTTGGCTCAGACGAGAAGGTGGCGTATATC
AAGAACGAGCTTAAGTTCGACGCGGCGTTCAATTACAAGACCACCTCGAC
CGACGATGCACTCGGGAAATACGCGCCGGACGGGATCGACATCTACTACG
ACAATGTCGGCGGCGAAGCCCTAGACGCCGCACTGGCCCATGGCAACCTA
AACGCTAGGTTTGTCGAGTGCGGGATGATCTCGCAGTACAACCTTGCTGA
CCCCAAGGATGCTTACCCCATCAGAAATATTATGTGGGTTGTTCCGAGAC
GGTACACTATCAGGGGATTCATCGTTGGTGATGCGGACTTTGGTCCAAGA
TATTATAAGGAGCACCAAGAGAATAT

Sequences in the Contig:

SY0AAA14YH02FM1 SY0AAA16YH09FM1 SY0AAA17YP14FM1
SY0AAA22YN07FM1 SY0AAA23YC22FM1 SY0AAA23YM17FM1
SY0AAA24YM07FM2 SY0AAA26YL09FM1 SY0AAA33YL15FM1
SY0AAA38YD10FM1 SY0AAA3YN12FM1 SY0AAA42YK16FM1
SY0AAA43YK19FM1 SY0AAA45YL07FM1 SY0AAA46YI17FM1
SY0AAA52YO20FM1 SY0AAA61YP21FM1 SY0AAA63YD13FM1
SY0AAA6YC24FM1 SY0AAA7YH21FM1 SY0AAA9YC23FM1
SY0AAB11YK03FM1 SY0AAB21YL23FM1 SY0AAB28YM12FM1
SY0AAB31YK23FM1 SY0AAB32YC04FM1 SY0AAB40YG24FM1
SY0AAB45YF10FM1 SY0AAB49YM18FM1 SY0AAB4YI19FM1
SY0AAB53YG15FM1 SY0AAB60YF18FM1 SY0AAB61YJ11FM1
SY0AAB7YO09FM1 SY0AAB7YP14FM1