Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig41
Length(NT) : 652
Best Gene Model Blast : Link to GSTUMT00000602001 E-value : 1e-130
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig41
TTGGGGATCATTCGGCGTGGGATCCCTTACCGTGCGAATATAAAAGGTGA
GATACCTAACCTCTACCGCTTTTTCAGCATGAGAACTTCTAAAATCCCCA
ATGATGATATCGCATCCATCGGAGCGGCCTGAGAAACCGTTTTCCGTGTC
AAATATGTTACAACCCCATCTGTATTCACCTTGATGAGGTATCCTTTGCT
GTTAGATTCTGAGCCACACTCACTCACTACAATTTTGTTTTCGCTATCAT
TTCCTTAACCTGCTTTACGGCTAACAAAATTTGCTATAATGACCAAGTCC
GACAAAGCCCATCACTCACGGAACAGCGCAGTGTATACAGCGGCATCTTA
GCGTAAAGCGAGACAAGAACCCTTTTTCAAAGAAAATAACAAGTTCGAAC
ATTTAATCTTTATTCTCATTCGTCTTCGTCGTCCCAGTTGGACACCATGT
GCTCCTCTTCCGCTCGGCAATTGGTAGACACGAATAAAGAAAAGTCACCC
CTCACTGGCGGTGGTGTCTTGGGCGGTGGTGTCTTGGGCGGTGGTGGTTT
GGGGAAACCCCCAGGGCAGAAATGTTTCGATTGTGATGGTATCTCCTGTT
GCTGCATTCCTTGTATCATCACCTGAGAGGGCCGGGCGCTTGTGATGGAG
AA

Sequences in the Contig:

SY0AAA11YH19FM1 SY0AAA4YP12FM1