Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4099
Length(NT) : 1059
Best Gene Model Blast : Link to GSTUMT00008017001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein CIMG_09554
Accession: ref|XP_001239933.1| Score: 984 E_value: 1e-104
KEGG Definition: translation initiation factor EF-2 gamma subunit, putative
Accession: afm:AFUA_4G07580 Score: 959 E_value: 1e-102
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0466 Score: 1017 E_value: 1e-111
PFAM Definition: GTP_EFTU, Elongation factor Tu GTP binding domain. This domain contains a P-loop motif, also found in several other families such as pfam00071, pfam00025 and pfam00063. Elongation factor Tu consists of three structural domains, this plus two C-terminal beta barrel domains..
Pfam Number: pfam00009 Score: 321 E_value: 2e-30
Swissprot: P32481|IF2G_YEAST
Gene Ontology:
GO:0005850 = Cellular component: eukaryotic translation initiation factor 2 complex
GO:0043614 = Cellular component: multi-eIF complex
GO:0005840 = Cellular component: ribosome
GO:0005515 = Molecular function: protein binding
GO:0003743 = Molecular function: translation initiation factor activity
GO:0006413 = Biological process: translational initiation

Sequence:
>Contig4099
TTGGTTTACTCGTAGACACTAAATTTCTCGCAAAACTTCACGATTCCTTG
CTGAACCCTCGCAATTTATTCCTTGCTTTTACCTCGCAGTTCTTTTTATC
GAGTTTCAAAGTCAGGAAAATCTCTTAATTCAACTTTCTATCATCTCGAC
ATCCCTCATCCACCCCACCTTCCACCCCACCTTCCATTCTTCCATCCCCA
CAATCATGGCAACTAACGGCGCAGAAGAAAGCATCACGTCTGAGCACGAC
GAGCATGTTGACAAACTCGGAAACTTTATTACTCAGGATGATGGAGGGAG
TCTCGGATCTCCTGGCTTGGATCCGCAGTCGGACGAATCCGATTTTGACG
ATGCTCCAAAAGAGCTCAAATCTTCCCTGAAGAAACCCACTCAGATCCAA
GAGATCGTTGCACCCAGACCACCTCTACCGGCACAACCTGATCCGGAGAC
TCTAGATCTTTCTGCGCTTTCTCCTCTTTCACCTGAAATTATCTCTCGCC
AGGCTACGATAAACATTGGTACCATCGGTCATGTGGCTCACGGGAAGAGC
ACTGTTGTGAAAGCTATATCTGGGGTTCAGACAGTCAGGTTCAAGAACGA
ACTTGAGAGAAACATCACTATCAAGCTTGGTTATGCCAATGCAAAGGTCT
ACAAATGTGATAATCCTGACTGCCCTCGTCCTGGGAATTACCGAAGTTAT
AAGAGCGATAAGGAAGTCGATCCTCAGTGTGAACGGGAAGGCTGTAGCGG
AAAGTACCAACTATTGAGACATGTTTCCTTCGTTGATTGTCCTGGGCACG
ACATCCTCATGAGTACTATGTTGTCTGGTGCAGCAGTCATGGACGCCGCT
CTCTTGCTGATTGCTGGAAACGAGTCATGTCCCCAGCCGCAGACTTCCGA
GCATCTGGCTGCAATAGAGATCATGAAGTTAAACCACATCATTATTCTTC
AGAACAAGGTTGACCTTATGCGTGAAGCGTCTGCTGAAGAGCATTACCAA
TCGATTCTGAAATTCATTCGTGGCACCGTTGCGGACGGTTCTCCAATCAT
TCCCATTTC

Sequences in the Contig:

SY0AAA16YL12FM1 SY0AAA36YL23FM1 SY0AAA48YB09FM1
SY0AAA49YO08FM1 SY0AAA55YG13FM1 SY0AAA62YB21FM1
SY0AAA63YC07FM1 SY0AAC24YN14FM1 SY0AAC26YK12FM1
SY0AAC34YL23FM1 SY0AAC62YE03FM1 SY0AAD5YN07FM1