Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4097
Length(NT) : 1912
Best Gene Model Blast : Link to GSTUMT00005900001 E-value : 0.0
Numbers of ESTs : 43

Blast Results:

Nr Definition: hypothetical protein BC1G_07480
Accession: ref|XP_001553920.1| Score: 2284 E_value: 0.0
KEGG Definition: t-complex protein 1, alpha subunit, putative; K09493 T-complex protein 1 subunit alpha
Accession: afm:AFUA_2G16020 Score: 2241 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0360 Score: 2077 E_value: 0.0
PFAM Definition: Cpn60_TCP1, TCP-1/cpn60 chaperonin family. This family includes members from the HSP60 chaperone family and the TCP-1 (T-complex protein) family..
Pfam Number: pfam00118 Score: 1200 E_value: 1e-132
Swissprot: O94501|TCPA_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0007021 = Biological process: tubulin folding

Sequence:
>Contig4097
GGAAAGGTGCTTGGAGTTCAACCCCCCACCAAAAACAACACCCAGGCACC
CCTTCTTCCTTCTCTAGTAACTAAACCGACCACAGCGCGAGTATGTCCGG
AATATTCCAGGGATCGAGAAACAATGGAACTTTATTTCTCGGAGGAGAGA
AAATTACAGGGTCGGATGTTAGAGATCAGAACGTTCTCGCCACACAAGCT
ATAGCGAATATTGTCAAGAGCTCGTTTGGACCTTCGGGGTTGGATAAGAT
GATGGTGGATGATATTGGAGATGTTACGGTTACCAATGATGGCGCTACTA
TTCTCAGTTTATTGGATGTTGAGCACCCTACCGGGAAGATCTTGGTCGAT
CTGGCTCAGCAGCAGGATAAAGAGGTTGGAGATGGAACAACTTCGGTCGT
GATTATCGCTGCCGAGCTCCTCCGTCGGGCAAACGAACTTGTCAGGAACA
AAATTCACCCAACTACAATCATAACCGGTTACCGTCTAGCCCTCCGCGAA
GCTGTAAAATACATGACAGAAGTAATGTCAGTAAAAGTTGAAACCCTAGG
AACCGAACCCCTCTTAAACATTGCAAAGACCTCCATGTCCTCCAAGATCA
TTGGTTCGGACTCAGACTTCTTCGCGCAGATGGTCGTGGATGCAATGCTC
GCCGTCAAGTCCACTAATACAAAGGCTGAAGTTAAATATCCCGTCAAGGC
AGTCAACATCCTTAAAGCCCACGGGAAGAGTGCTACGGAGAGTATGCTCG
TTAAAGGGTACGCTCTTAACTGTACTGTTGCTTCCCAAGCTATGCCCACG
CGGATTCTGAATGCAAAGATCGCATGTTTGGACATGAATTTCCAGAAGAC
AAGGATGGCATTAGGTGTTCATATTACTGTTGACGACCCTAACCAGCTGG
AGGCAATCCGACAGCAGGAGTCAGAGATGGTTCTCGAGAGGATAAAGTTG
ATTCTAGACGCTGGTGCAAACGTCATCCTCACCACCAAGGGTATCGACGA
CCTCTGCTTGAAGACGTTTGTAGAGAAAGGAGCTATGGCTGTACGCCGTT
GCAAGAAGGAGGACCTCAGAAGGATCGCAAAGGCCACTGGCGCAACGCTA
GTCAGTTCGCTTTCGAACCTGGAAGGAGATGAAGTCTTCGAGGCCTCATC
CCTCGGATCTGCAGAGGAAGTTGTCCAGGAGCGTATCTCAGATGATGAGT
GTATCTTGGTGAAGGGCACCAAGTCATACTCCTCTGCATCCATCATTCTC
CGAGGGCCAAACGACTACCAACTCGATGAGATGGAGCGCTCAGTCCATGA
CTCCCTCTGCGCTGTCAAGCGCACCCTCGAGAGCGGGAAAGTAGTCCCCG
GCGGAGGAGCCGTCGAAACCGCCTTGAGCATCTACCTAGAGAACTTTGCT
ACCACAGTCGGATCCCGCGAACAATTGGCTCTCGCAGAATTCGCCTCTGC
CCTTCTAGTCATTCCCAAAACATTGGCCATAAACGCAGCAAAGGACTCCT
CAGACCTAGTCGCCAAACTCCGCTCCTACCATGCTGCCTCGCAGACCGCC
GCTGAAACTGAGACCAAGAAGCGGAATTACAAGAACTATGGGTTGGATTT
GATGAAGGGCAAAGTTGTGGACGAGGTTAAGGCTGGCGTGTTGGAGCCTA
CGATGAGTAAGGTTCGGAGTTTGAAATCTGCTGTGGAGGCATGCATTTCC
ATCATGAGGATTGACACTATGATTAAACTAGATCCGGAGCAAAGACAGGA
GGATCCTCACGAGGGTCACTAATCTATGGACCCCAAAGTTGGCTGGTTCG
AGCTTGTGATGTTTCTAAGGTTAACTGAAACCCCTAGAATAAAAGAGATT
GAATGGTATTTTCCATCTATATAGCTCCGCTTAGAATTCAATGACAATTT
ATTTTCCTAACT

Sequences in the Contig:

SY0AAA11YA22FM1 SY0AAA13YC18FM1 SY0AAA18YK03RM1
SY0AAA19YG03FM1 SY0AAA21YJ06FM1 SY0AAA23YJ11FM1
SY0AAA23YJ11RM1 SY0AAA27YH24FM1 SY0AAA32YH22FM1
SY0AAA35YC21FM1 SY0AAA35YD21FM1 SY0AAA36YI08FM1
SY0AAA3YH10FM1 SY0AAA41YH16FM1 SY0AAA44YA18FM1
SY0AAA44YK23FM1 SY0AAA45YA16FM1 SY0AAA47YE09FM1
SY0AAA50YC04FM1 SY0AAA52YC05FM1 SY0AAA60YK13FM1
SY0AAB12YK04FM1 SY0AAB15YG23FM1 SY0AAB29YG07FM1
SY0AAB37YA11FM1 SY0AAB41YP12FM1 SY0AAB44YC08FM1
SY0AAB45YG18FM1 SY0AAB48YJ16FM1 SY0AAB49YA02FM1
SY0AAB49YD21FM1 SY0AAB53YD11FM1 SY0AAB57YK08FM1
SY0AAB60YD13FM1 SY0AAC11YN10FM1 SY0AAC18YP07FM1
SY0AAC24YM16FM1 SY0AAC31YM09FM1 SY0AAC31YM09RM1
SY0AAC38YN17FM1 SY0AAC3YH22FM1 SY0AAC55YN03FM2
SY0AAD46YM19FM1