Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4096
Length(NT) : 452
Best Gene Model Blast : Link to GSTUMT00009400001 E-value : 4e-16
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4096
TTGGCCACCACAACCACCACCACCACAACCACCACCACCTGCTTGAGAGA
CAAAAGTCTCGCCTTTTCACACTTTCTCTGCTTTTATTAATCGAGATAAA
GGAGGAGCAGCTCAGCAAGCCTGCTCGACTAACCCTCACGAAGGAAGGAA
GGGAACTGAAGAAGAAAGAAGGAGAAAGGTCTACTGCCACAAAGATGCCG
CAACCATGGGACTATATTGCTGTAAGTCACGTTCGAACGGTAGTCACTTG
ACGGAGGGAATCACACTGACAGACCGGACGACAATACAGAAAGTTGTTAA
CATCGGCGACTCCGGGTGCGGAAAGAGCTCGGTGCCTTTTCCCCCTCCCC
TCCCCCGCCCCACCCGTTCCACCCCCATCCCATTCATCCACCCATCCATC
ATTTTACCCATCCATGAGTGTAATCAAACTGACAACGACTGAAAGCTCAC
CA

Sequences in the Contig:

SY0AAC12YK08FM1 SY0AAC24YM11FM1