Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4095
Length(NT) : 1023
Best Gene Model Blast : Link to GSTUMT00008591001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG06263.1
Accession: ref|XP_386439.1| Score: 319 E_value: 1e-27
KEGG Definition: hypothetical protein
Accession: fgr:FG06263.1 Score: 319 E_value: 6e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4095
TTGGCAACCGCTCTCCTCTGTCACCCTTTCTAGAGGGCCCCGGCTCTTCT
TTTTTTTTTTCCTTTTTCTTCTATGTGCGCGCGCGAGAGAGTAAGAGTGA
GTGAGAGTGTGTTAACTTATGAGTGAGCGAGTGAGCGAGTGAGTGACAAA
TAGCGACTTATTGCTATTTGTACCACAGTACTATTTTCCATTTACCTTGT
TATTTTTATTGTCGTGGTTTGAATATTGATTCTGGTGTGGTTCTGGCCTT
CAAATTTTAGCGTGCGCAAAGCTGCCCCTCAATAACCAACCACCTCTCTA
TCACAATTATGGATTTACTTCATATGCCCCCATATGGTCTAAAGGAGCTT
ATCCTTTCTCATCCTTTTCTCAAAGCATATGGACTTGGCTTCTTGTACTA
TCTAAGTCCTCGCATTTTCGGTCTCGTGCTCTCGAAAGTTAAGCAGAGAA
TAAGCAATAAAAAGAGCAATGTTGTTTCACCTGCAATTATAGATATTTTG
AGAAAGTCCTCCGAACTTCACCGCTTTCCCGCATTTTGCGGCGTCATAAT
AGGTGGTTGGCATGTCTTACAACCAATCTTCGAGAAGTTTTTCGTGGCTG
TCGGTAAATTTTCCGAGCCTCTGGGTGCCGAAAAGACTATCGGTGAACAG
AGACGCAGGGTAGCTACATTTTTGGCATCCGCATCGGCTGCGGCTGTCGC
CATACGACAATTGAACAGTCGTAGTGTAGAGATCACAGCAGGGCGAACGC
TGGATCTCACTCTCTTTGCTGTCGTGAGAGCCCTGGACGTTGTGATTGGT
GAAATTTGGGCTCGCAGAAAAGCCCACCGGGTCCACTCTAGGACCCTTGC
TAGACTTAATAGGATCATTGAAAATAATGTTGATGCAGCTATATTTGCTG
CAAGTGCTGCAGTGATAATGTTTTCCTGGTTCTATGAACCAGAAAAGCTG
CCATCGTCTTACAATAAGTGGATAACTGAAATTTCTGAGGCCGATACTCG
TCTGATAACGACTTTGAGGCGGA

Sequences in the Contig:

SY0AAC24YL21FM1 SY0AAD2YM06FM1