Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4094
Length(NT) : 1491
Best Gene Model Blast : Link to GSTUMT00012070001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: Putative transcription factor kapC
Accession: sp|Q2UNX4|KAPC_ASPOR Score: 205 E_value: 4e-14
KEGG Definition: predicted protein
Accession: aor:AO090001000194 Score: 196 E_value: 2e-13
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0956 Score: 132 E_value: 2e-08
PFAM Definition: No Hit Found
Swissprot: Q2UNX4|KAPC_ASPOR

Sequence:
>Contig4094
TTGGCGAACGGGCGAGCGAGCGAACGAACCGAAGTGTGATAAAACATTAT
TATTATTTTTTATTTTTTCTCCATTTCTTTCTCCAAGCGAAGGCTATTTT
CTTTCAACTCGAGAAAGTTAGAACGTCAAAAAACAAAACAAAAAAAAAAC
GCATTAGTCAAATAATAATCCTGCATCCCCGATCCATAAACTACCCCCCC
CACCCCGACAGGACAGGAGAGCACAGGAACAGGCACTTCTCTTACCCAGA
GCTTTCGAGAACAACGAAAGGCAAAGTAAGCCATTTTTATAAAATGCAGC
AGTCAACGCTCGCTCCGGCTCCTCATCCTCTGCAGTCGCCTAGCGCACAG
GAAGCAGCGAATACCGCAGAGCAGACTCTTCGTGCACATCTGCTCCCGCA
CATCCACTCTCCCCAACAACAACAGCAGCAGCAGCAGCAGCAGGTCCAGC
AGCAGGTCCAACAGCAACAGCAAAACGTCACAAGCCCTGATAACAAACCG
ACCGACTCGGCAAGTCCTGACCTCAACATCGATCCAGCTATCAGTGGCGT
CGGCGCTTCCGGGGGCGTGAGTAGTGTTCCGCAGAGTCCAGGCTTAACGA
CGATGGCGATTCAGGGCATGTCTCCGGGCTCACAGGCGGCGATGGAACAG
CATAGCGGTGCAGAGGAGACGCAGGCGGAGGGATCTTCTGCCGGCAGGGG
CCGCGGTGGGAAACGCGAATTGTCAACGAGTAAGCGGGCCGCGCAAAACC
GTGCTGCGCAGAGAGCTTTCCGCCAACGCAAGGAAGGCTACATCAAAAAG
CTGGAAGAACAGGTTAGAGACTTCAACCAGATGCAAGAATCCTACAAACA
GATACAGGCCGAGAACTATCAACTCCGCGACTACATCATCAACCTGCAAT
CCCGCTTAATAGAGCACCAAGGCGAAGAAGCTGTCCCACCGCCACCCCTA
CCACTACTAGGCTCTTCCTCCTCTACCACCAGCGCCATCCCCCTACCGAC
CACCACCACCACTCCCGCCCTCCCCCCACAGCAGCAACAGCAGCCCCCAC
ACCCACCGCTCACAGACCCCTCCGCGCCAACAGCAAACATGGGTACCGTC
GTCGAACTCTCCAGCAATTCAGCAGCTAATCCCCCAGCGAGTAATCCTGT
GGGTGCGAAGCGCGCGCACGAGGACGACGCGGCGAATGCATTTCTGCAGG
GTGTCGCGGCAGCCGGAAACGGGTTTTTGCAAGCGCAGCAAGTGGCTGCT
GCGGCTGTAATCACTGGAACCGGAACTGGGGCTGGAAGTGGTGGTGGTGG
TGGTGGTGGTGGTGGGGGCAAGAGGCTGAAGAATGGGGATGAGAGTGGTG
TTAATGGCGCCTAGCCTTGGAGACTCTGTGAAGATTTTGGAGAGGAGTTG
AGTTGGCAGTGGTGGACGGACTTTTTTTTTTTCCTCTTTCTTCTCGTTTC
CTTTTGTTTTGCTCGGTTTTTCTATCTCTTCCCTTTTCTTT

Sequences in the Contig:

SY0AAA13YE20FM1 SY0AAA1YJ13FM1 SY0AAA49YJ09FM1
SY0AAA52YF11FM1 SY0AAA52YO18FM1 SY0AAA53YK14FM1
SY0AAB11YF20FM1 SY0AAB36YC05FM1 SY0AAB45YM23FM1
SY0AAB48YN10FM1 SY0AAC14YH22FM1 SY0AAC24YL15FM1
SY0AAC39YG17FM1 SY0AAC46YI12FM1 SY0AAD24YF03FM1