Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4092
Length(NT) : 2358
Best Gene Model Blast : Link to GSTUMT00008606001 E-value : 0.0
Numbers of ESTs : 151

Blast Results:

Nr Definition: D-3-phosphoglycerate dehydrogenase
Accession: ref|XP_001273886.1| Score: 1764 E_value: 0.0
KEGG Definition: D-3-phosphoglycerate dehydrogenase [EC:1.1.1.95]; K00058 D-3-phosphoglycerate dehydrogenase
Accession: afm:AFUA_5G05500 Score: 1760 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0068 Score: 1141 E_value: 1e-125
PFAM Definition: 2-Hacid_dh, D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain. This family represents the largest portion of the catalytic domain of 2-hydroxyacid dehydrogenases as the NAD binding domain is inserted within the structural domain..
Pfam Number: pfam00389 Score: 876 E_value: 2e-94
Swissprot: P40054|SERA_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0042802 = Molecular function: identical protein binding
GO:0004617 = Molecular function: phosphoglycerate dehydrogenase activity
GO:0009070 = Biological process: serine family amino acid biosynthetic process

Sequence:
>Contig4092
TTGGCGACCACTTCTTTTTGTTACACTCTTGAGGAAGGTATTTGACATTT
TTACTCTCAGTTCTCCAGCCAAGTAAGGAAATTGTCATAGAAGAGAATAA
ATCGCCACCGGGAAGACTTATCTCTCATACATATAGGGAAAGGAAGGAAA
ATCCTTTATCAATGTCGAGTAAAATCAGGTCATTATTTCAGGGATTCCGG
TCCTCTCTAGATGGGGAGAGAGGAACGTCTGGAGGTTTCTCCGGTGCCAT
TGCCCGTAGCGGCAGCCCTACCAGCAGCACAGACACGAGTGCTCGTGACT
CGAGTCCAGTGGCTATTCTAAGAAGGGCTCCGCCAACCCCACCAGATGAA
AAAGATAACCGCCACCATTTGGAAACTCTTCAACAGAGCATTCCTATCAA
TTCAAAAAATTCCTCCTCCGATAGCAACAACAACCACAATCACCACGAAA
ACTGCCGAAATTGTGAGAACATGACAGACCCACAGCAAATCGAAGTGAAT
GGGCTTGCTCATGCCATATCTCACACACTTAGCCTGTCCAATTCGCCCAC
CTCCGTTTTCCACTCTCCGGTGGGCTCGTACAGCTCTAGGACTACGCTCA
ACCGACCTTCGGGAAAACAATTGAAACCGTTTAACACGCAGGATATTAAA
ATTGTGCTCTTCGAAAACGTTAACATCGCGGCAAGAGAAATTTTAGAGTC
TCAAGGCTACCAGGTTGAATTTCACAAGTCTTCCTTACCAGAAGACCAGC
TTATTGAAAAAATTCGGGATGTTCATGTTATTGGAATCCGCTCAAAGACA
AAGCTCTCTGCGAAGGTGTTGCGTGAGGCGAAGAATCTGCTTGTGATTGG
GTGCTTTTGCATTGGTACTAATCAGGTGGATCTCGAGTATGCTGCCAAGC
ACGGTATCTCGGTCTTCAACTCCCCGTTCAGTAATTCCAGAAGTGTTGCC
GAGCTTGTCATCTCTGAGATTATCGCTCTGGCGAGACAGCTCGGCGACCG
TTCGATGGAGATGCATAATGGCACCTGGAACAAAATCAGTACCAAGTGTT
GGGAGATCCGTGGAAAGACCTTGGGGATCGTTGGGTATGGTCATATTGGA
TCGCAACTATCAGTTTTGGGCGAGGCTATGGGAATGAAAGTTCTTTATTT
TGATGTTGTTCCTTTGATGGCCCTTGGTACCGCCAAGCAGGTTCCTACTC
TTAAGGATCTCCTCGAACGGGCTGACTTTGTGACTCTTCATGTTCCGGAA
ATTGCTGAGACAAAGGACATGATTGGAGCTGAGCAATTGGCTCAAATGAA
GCAAGGAAGCTATCTCATAAATGCTAGTCGTGGAAGCGTTGTCGATATCC
CTGCATTGGTTGAATCCATGCGCTCTGGACACACCGCGGGTGCAGCTCTT
GACGTCTATCCAACTGAACCAGCGGCCAATGGTGATTATTTCAATGACAC
ACTCAACTCCTGGGGTAACGACCTGAGATCTCTAAAGAACCTTATTTTGA
CTCCCCATATCGGTGGGAGCACTGAGGAGGCTCAGAGCGCAATTGGTATT
GAGGTTGGAGAAGCCCTAGTCCGGTATATCAACTCTGGAAGCACTATTGG
GTGTGTTAATATGCCGGAGGTGACTCTTCGTTCTCTCACTCTTGCAGAGG
AGAACCACGTCCGTGTTATATTCATCCATAGCAATAGGCCTGGTGTTCTG
AGGCAAGTCAACTCTATTCTTGGGGACCACAACGTGGACAAGCAAATGAG
CGATAGTCGAGGCGACGTCGCATATTTGATGGCAGACATTAGTGATGTCA
ATGCTGGAGATATCCGCAGTCTCTACGAGAGCTTGGAAGCCTTGAGTTCT
AAAATAATGACGAGAGTTCTGTATTAGTAACATTAGTTTCTGATCTATCT
TCTTTTGTTTTTTATTTTAGTTTTTTTTGAATTTATTGCCATCGGTTCTT
TCCTGTTCTCTTTTCTAGAAAATTTTCGTTGTCCAACCTCGTACGTGGGT
GTTAATACCTGCAGTCAATAGGTTGGTAATGCCAAAATTCTAATGCCAAA
GTGAGAAGGTCTTATCGCTGTATTTCGGCATCCCCATATTTTAGTTTCAA
CACCGCACTGTTTATTGTCTTATTTTCTGTTCATGTCTCGATGGATTGGC
CGTTCGATCTTTATTTGCATTTTGGTGGGCGTTCAATTCAAGTTGGGGAT
TGAGGGTACGGTACGGGAGAAAGGAAAAATCATGTCTAGGGCGCTTATGC
CGTAGTAAGTTGTATATCCAAAGGCTTGAATAGGAGTGGTAGTGGGAGAT
TTGGATTTAGGGAAAATAAGAGCTGTTTCAACACGTCAATAATGACTGGC
TTAAACTT

Sequences in the Contig:

SY0AAA14YO02FM1 SY0AAA17YN21FM1 SY0AAA21YJ19FM1
SY0AAA22YI03FM1 SY0AAA24YI16FM1 SY0AAA24YI16FM2
SY0AAA24YI16RM1 SY0AAA25YE08FM1 SY0AAA29YG06FM1
SY0AAA30YP11FM1 SY0AAA33YC16FM1 SY0AAA34YM16FM1
SY0AAA35YO10FM1 SY0AAA39YI22FM1 SY0AAA3YP12FM1
SY0AAA44YI09FM1 SY0AAA46YG18FM1 SY0AAA47YJ03FM1
SY0AAA48YO20FM1 SY0AAA50YK06FM1 SY0AAA56YL04FM1
SY0AAA58YI14FM1 SY0AAA58YJ01FM1 SY0AAA60YE17FM1
SY0AAA6YA12FM1 SY0AAA9YB03FM1 SY0AAB37YJ04FM1
SY0AAB37YM21FM1 SY0AAB39YJ24FM1 SY0AAB3YH09FM1
SY0AAB44YG15FM1 SY0AAB44YP22FM1 SY0AAB49YJ19FM1
SY0AAB54YA05FM1 SY0AAB57YE12FM1 SY0AAB61YI14FM1
SY0AAB6YB07FM1 SY0AAC10YD01FM1 SY0AAC11YC17FM1
SY0AAC11YG04FM1 SY0AAC11YK10FM1 SY0AAC12YF04FM1
SY0AAC12YP15FM1 SY0AAC15YP02FM1 SY0AAC15YP21FM1
SY0AAC17YF17FM1 SY0AAC19YM24FM1 SY0AAC19YM24RM1
SY0AAC20YG03RM1 SY0AAC20YP20FM1 SY0AAC21YG24FM1
SY0AAC21YG24RM1 SY0AAC21YH15FM1 SY0AAC21YH15RM1
SY0AAC21YL01FM1 SY0AAC22YC20FM1 SY0AAC22YL10FM1
SY0AAC24YJ15FM1 SY0AAC25YD08FM1 SY0AAC26YK06FM1
SY0AAC26YK06RM1 SY0AAC28YH05FM1 SY0AAC28YH05RM1
SY0AAC28YI22RM1 SY0AAC29YC24FM1 SY0AAC2YB13FM1
SY0AAC2YJ17FM1 SY0AAC30YA08FM1 SY0AAC30YB07FM1
SY0AAC30YB11FM1 SY0AAC31YL07FM1 SY0AAC33YG08FM1
SY0AAC37YO02FM1 SY0AAC38YA10FM1 SY0AAC38YN10FM1
SY0AAC39YN14FM1 SY0AAC40YI14FM1 SY0AAC41YG15FM1
SY0AAC41YM04FM1 SY0AAC42YN04FM1 SY0AAC43YF19FM1
SY0AAC44YE23FM1 SY0AAC44YJ18FM1 SY0AAC46YI13FM1
SY0AAC47YE16FM1 SY0AAC47YF24FM1 SY0AAC48YL15FM1
SY0AAC4YG15FM1 SY0AAC51YE05FM1 SY0AAC51YG19FM1
SY0AAC52YI18FM1 SY0AAC53YK04FM1 SY0AAC54YA05FM1
SY0AAC54YJ20FM1 SY0AAC57YD08FM1 SY0AAC57YG24FM1
SY0AAC59YF14FM1 SY0AAC61YC08FM1 SY0AAC61YI03FM1
SY0AAC7YA18FM1 SY0AAC8YG10FM1 SY0AAC9YC09FM1
SY0AAD10YC14FM1 SY0AAD12YI09FM1 SY0AAD12YN18FM1
SY0AAD1YP12FM1 SY0AAD20YM05FM1 SY0AAD21YD09FM1
SY0AAD21YL08FM1 SY0AAD22YL16FM1 SY0AAD25YL09FM1
SY0AAD28YB01FM1 SY0AAD28YK03FM1 SY0AAD2YD12FM1
SY0AAD2YN01FM1 SY0AAD31YA01FM1 SY0AAD31YJ20FM1
SY0AAD31YM11FM1 SY0AAD33YG22FM1 SY0AAD33YP22FM1
SY0AAD36YB12FM1 SY0AAD36YO08FM1 SY0AAD3YE15FM1
SY0AAD3YK21FM1 SY0AAD3YN17FM1 SY0AAD40YB10FM1
SY0AAD41YD08FM1 SY0AAD42YH18FM1 SY0AAD43YA19FM1
SY0AAD43YC02FM1 SY0AAD43YP08FM1 SY0AAD44YJ22FM1
SY0AAD44YM04FM1 SY0AAD46YF05FM1 SY0AAD48YN07FM1
SY0AAD53YH08FM1 SY0AAD55YA10FM1 SY0AAD55YJ22FM1
SY0AAD56YJ17FM1 SY0AAD56YK12FM1 SY0AAD59YA04FM1
SY0AAD59YF03FM1 SY0AAD59YH19FM1 SY0AAD60YJ19FM1
SY0AAD61YG07FM1 SY0AAD63YL22FM1 SY0AAD6YN02FM1
SY0AAD7YE04FM1 SY0AAD8YB03FM1 SY0AAD8YK17FM1
SY0AAD9YN10FM1