Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4091
Length(NT) : 1648
Best Gene Model Blast : Link to GSTUMT00000035001 E-value : 0.0
Numbers of ESTs : 41

Blast Results:

Nr Definition: hypothetical protein CIMG_06675
Accession: ref|XP_001242779.1| Score: 1245 E_value: 1e-134
KEGG Definition: hypothetical protein
Accession: ang:An07g03850 Score: 1224 E_value: 1e-132
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2772 Score: 1157 E_value: 1e-127
PFAM Definition: Transaldolase, Transaldolase..
Pfam Number: pfam00923 Score: 848 E_value: 3e-91
Swissprot: O42700|TAL1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0009052 = Biological process: pentose-phosphate shunt, non-oxidative branch

Sequence:
>Contig4091
TTGGATATGAATGATTGGAGGTTTTCTCCGTTTCAATAGATTTATTGCTA
TGATAACAATAAACTTTATAAATCATGCTTGGCATTAATGCTATGCCATG
TCATTCGGGGAACCTCCTTAGCAGCAACGATGGTCTTTTGGAGAATGGGT
GAGATTCCTCATCGACTGCCGAGCTACTCTGCGTGTGCAAGTATTATCAA
CCCCTCATCGAGTTGCGCTTGCCCCTCCCCATCGATACAGCCACGCCTCC
CTTTCAACCCGCAGACCACCGCAAGCCTCCCTTCCGTAACTTAACTTGAT
TCTTTCTTACTTCCTCTCTTCCATTCCATCTCCTCTCCCCTCCTCTTCAC
CACCGCACCTCCCGCTTCTCTAATACCCGAAACGCGCAACACTTCTGCCG
TCGTTCTCGCATTTTTGAACAATCACAACAATTATGACTACCTCTCTCGA
TCAGTTGAAGGCCACTGGCACTACTGTCGTTTGCGACTCTGGTGACTTTG
CTACTATTGACAAGTACAAGCCTCAAGATGCCACTACCAATCCATCTTTG
ATCCTCGCCGCCTCCAAGAAGCCTGAGTACGCTAGGCTCATCGATGAGGC
CGTTAAGTACGGAAGGTCCCATGGCGGAAACATCGATTCCCAAGTTGATG
CCACTTTCGACCGTCTTCTCGTTGAATTTGGAAAGGAGATTCTTAATATC
GTCCCCGGCAAGGTGTCTACCGAAGTCGATGCCCGTTTCTCTTTCGACAG
ACAGGCCTCTATTGATAAGGCTCTCCACATAATTGACCTGTACAAGAGCA
TCGGTATCGACAAGGGCCGTGTTCTCATCAAGATTGCCTCCACTTGGGAG
GGTATCCAAGCTGCCAGGGAATTGGAAAGCAAGCACGGAATTAAGTGTAA
TTTGACTCTTTTGTTCTCAGAGGTCCAGGCTATTGCTGCCGCCGAGGCGG
GCGCTTTCTTGATTTCGCCTTTTGTTGGCAGAATTTTGGATTGGTATAAG
GCCTCCACTGGAAAGGCTTATGTTGCCCGCGAGGACCCTGGTGTTAAGTC
CGTCCAGAATATCTTCAACTACTATAAGAAGTACGGATACAAGACCATTG
TTATGGGTGCCTCTTTCCGTAATACTGGTGAGATTACCGAGCTTGCTGGT
TGTGACTACCTTACAATCTCTCCCAACCTTTTGGAGGAGTTGTACAACAG
CCAGGCTGCCGTCCCGAAGAAGCTTTCTTCCGAGGACGCCACTGCTCTGG
ATATCGCCAGGAAGAGCTTCATTGACAATGAAGCCGAGTTCAGGTTCTAC
TTGAATGAGGACCAAATGGCCACCGAAAAGTTGAGCGACGGTATTAGAAA
GTTTGCTGCCGACGCTGTTACTTTGAAGGAGATCCTCAAGGCGAAGCTTG
AGAGAGCTTAAATCGGATATGAGAAAGGTAATATAAAAAAAGTATTGAGC
GAACAGGTATATGGATTTTTGGTCTGTGTAAGCTTTAGCTTTTCCAGGGG
TGTTTTTCACTTTCTTGCCTGTTGGTCTACCTTTCGTATAGGCTTCCCAG
TCCGCTCTACTTGTTCGTAAGGTTCATGTTTTGGTTCTCAATCTCAGTCA
TAGTTTTTTTTTTTTCGAACCAAAGGACGCAACCAATAATGATATCTC

Sequences in the Contig:

SY0AAA18YL03FM1 SY0AAA20YN07FM1 SY0AAA20YN07RM1
SY0AAA24YN06FM1 SY0AAA24YN06FM2 SY0AAA42YK21FM1
SY0AAA44YP03FM1 SY0AAA47YO17FM1 SY0AAA48YP12FM1
SY0AAA54YB15FM1 SY0AAA60YH18FM1 SY0AAB17YG21FM1
SY0AAB19YP17FM1 SY0AAB23YL03FM1 SY0AAB2YM12FM1
SY0AAB35YM02FM1 SY0AAB47YF04FM1 SY0AAB48YA09FM1
SY0AAB4YM21FM1 SY0AAB56YE04FM1 SY0AAB56YH24FM1
SY0AAB57YG11FM1 SY0AAC14YJ02FM1 SY0AAC21YH02FM1
SY0AAC21YH02RM1 SY0AAC24YJ02FM1 SY0AAC30YC14FM1
SY0AAC36YJ16FM1 SY0AAC43YK04FM1 SY0AAC51YJ19FM1
SY0AAC56YL17FM1 SY0AAC61YD07FM1 SY0AAD15YH16FM1
SY0AAD18YG13FM1 SY0AAD22YP22FM1 SY0AAD23YG20FM1
SY0AAD40YE18FM1 SY0AAD58YG16FM1 SY0AAD62YD09FM1
SY0AAD63YE24FM1 SY0AAD7YL06FM1