Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4089
Length(NT) : 1127
Best Gene Model Blast : Link to GSTUMT00009185001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_01288
Accession: ref|XP_001560456.1| Score: 709 E_value: 9e-73
KEGG Definition: hypothetical protein
Accession: fgr:FG11600.1 Score: 564 E_value: 3e-56
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4089
TTGGACCTCACCAACCAACCAAACTATTCACTACAACCACCACCACCAAA
GCCCCTCGAGGGAACCACGAAAAGCATGCTAAACCGCACCCTACCAGAAC
TCCTCTTCATAAGAACTTGCATAGCATCCTTACGATCCATCCCCCCGGTC
AGCACCCTCTATACCATCTCTCGATTCACCATTCTACCATCCAACTTCCG
TTTGCCAATAGCACTAGAGGTATACCTGTTTGCGGAAGCACTATTCTTCA
CAGCGGTGTACATCCCTCGGAAACTAATATTACAAAAACCAGCGCAACAC
CCCCCGCTCTCCCCGCGCTCTAACCGACAGGCTCTGTTCGAGAAATGCAT
TGACAAGACGCCAGATGTGAACGCGTACCTTTCCGGCTGGTTCCATGGCG
CCGCCGTGGAAACAATTAAGCGGGAGAACGTGAGGGAGTTTCTCTCTTGG
GCCTTCTTAAACGAGTCGTGGAGCGGAGGGACGGAGGAGTTTGCGGAGTT
GGAGGAGTATGTCTGTCTCCTTGAAAGGAGGCTTGGAAGGGAACTCGAGA
GGGGGTATAATAAGAGGGTGAAGTGCGTTAGGTTAACGGTTGATGGAACG
GTCATGGAGTATAGGAGTTTGCTCTGGTATTCTGTTGTTTTTATCGTAGA
TTTAACAACTTGCATACGCTTCCGCCTGCACTCTTTCAACCATTTCGCCC
CAAGAGCCTGGTTCCGTATCATCCCACCACGCCCACACACAACCTTCTCC
TCCCTCTCATCTGCGCGACACATCTCATACTGGCACCGTCCACATACCCA
TCCCACCAAGCTCCCCATCGTCTTCCTCCATGGCATCGGCATAGGACTAT
ACCCTTACATACCCTTCCTGCACGACCTCGCAACTCTAGATCCAGAAGTC
GGCATTTTAGTCTTAGAACTCATGCCGATAAGTTTCCGCTTCTCGCACAC
CCCACTATCCAGGCCTGCCTTCACGGAGGAATTCACGTCCATACTGGCGC
AGCATGACATCCGAAACTTTATGCTGATCTCGCACTCCTATGGGACCGTG
TTATCAACCTGGTTACTACATTCCGAGCACCTATCTCCAAGGATCTCATC
CCTAATGCTTATGGATCCGGTGACCAT

Sequences in the Contig:

SY0AAA24YG08FM1 SY0AAA24YG08FM2 SY0AAC24YH20FM1