Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4088
Length(NT) : 957
Best Gene Model Blast : Link to GSTUMT00010617001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001544131.1| Score: 519 E_value: 1e-56
KEGG Definition: hypothetical protein
Accession: ang:An11g10210 Score: 464 E_value: 6e-52
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4322 Score: 140 E_value: 2e-09
PFAM Definition: No Hit Found
Swissprot: Q9P4W7|APC5_SCHPO
Gene Ontology:
GO:0005680 = Cellular component: anaphase-promoting complex
GO:0005515 = Molecular function: protein binding
GO:0031145 = Biological process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process
GO:0008054 = Biological process: cyclin catabolic process
GO:0007091 = Biological process: mitotic metaphase/anaphase transition
GO:0016567 = Biological process: protein ubiquitination

Sequence:
>Contig4088
CCTTCCCCAATAACAGTCGGAGATACTAATTACCACCCCCATCCAACCAG
CTTCTGGCAAGATAGCCCTCCTTGCCCTCGTAGAACTCTACGCAGAGTCG
CGCTTCCCCAACCAATCCGTGGTCCCGGTCCTCTCTTTCGTGATCCGGCA
CCTGGTGAGCTCGAAAGAAAACACCGCCTTCATCCTGACCCTCGAGAACA
TAAAGTCCGCAACACTGCACCAGCCCAGCGCAGTCGTAGGTCGCACGATC
TTCGACTTGCTGCTGAAGAAACTGTGGGAAATCAACTCCTTCGATGCCCT
TCACACGTTCTTTGCGAACATACAGACTTACCTGATTGAGCCCGAGCGCG
CGGATAAGTCCCCAGTGAGGGTGCATGGGGAGAAGTCCATGTTGAGTAGG
ACTTCTGTCCTGGGGTGTTTTGTCAGGAGGGCGGCGCTGGAGTATGTCCG
GTTGCAGTTTCATGACGCCGTGTCTCTGTGGAGGAGCTTTATTGCTTATC
GTGAGCCGACGTTGGCGATGTGGAAGAAGAGGAATTTGGGCGCTGGGCCG
ATGAGCTTTGATGCTAATTTGAAGGGGTTGGGGTTTGGTGATGGGATGGT
TGGGGTGGTTTATGGGAAGGGGAAGGAGAGCCGGGATTGCACTGTTTCCA
CAGACGATGTGGAAAGACTATTGGAATTCCAGGTGGACTCTATGCAGAGA
ATGGGCACGAGGATACCGGATGACATGCAGGTCCAATTGAGGCAGATGCT
TAGTACTAATGTTACTATTCCTGCGTTGACGCATTATGTTGAGTGAGCAG
TATGCCTATTTTGAGATTTGCCATTGTTGGAATGGTTGGTTGATTGGTTC
GTTTGGGTAGGTTTCTGAATTCCTGGCGGTCGGGGGATTATCCGGGGTCA
TTTGATAATTTGCACCGGTACCTTTGACTATACGATGCATAATCGAGATC
GAACCTT

Sequences in the Contig:

SY0AAB40YD14FM1 SY0AAC24YH09FM1 SY0AAC28YK24FM1
SY0AAC29YO19FM1 SY0AAC30YF19FM1 SY0AAC54YI21FM1
SY0AAC61YI12FM1 SY0AAD16YG11FM1 SY0AAD17YK07FM1
SY0AAD30YG21FM1