Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4086
Length(NT) : 1982
Best Gene Model Blast : Link to GSTUMT00007687001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein An14g04860
Accession: ref|XP_001401109.1| Score: 728 E_value: 1e-74
KEGG Definition: hypothetical protein
Accession: ang:An14g04860 Score: 728 E_value: 6e-75
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1929 Score: 321 E_value: 3e-30
PFAM Definition: BRCT, BRCA1 C Terminus (BRCT) domain. The BRCT domain is found predominantly in proteins involved in cell cycle checkpoint functions responsive to DNA damage. It has been suggested that the Retinoblastoma protein contains a divergent BRCT domain, this has not been included in this family. The BRCT domain of XRCC1 forms a homodimer in the crystal structure. This suggests that pairs of BRCT domains associate as homo- or heterodimers..
Pfam Number: pfam00533 Score: 160 E_value: 2e-11
Swissprot: P32372|RAD4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005819 = Cellular component: spindle
GO:0005515 = Molecular function: protein binding
GO:0006281 = Biological process: DNA repair
GO:0000076 = Biological process: DNA replication checkpoint
GO:0031574 = Biological process: S-M checkpoint

Sequence:
>Contig4086
TTGGCTCGAAAGAAGGAAGGAAGGAAGGAAAGAAGGCAGATCTTCGCACG
CGCTTTTTCATCGGAAACTCAACCATGGCCGATCAGGCTGATATCACGCG
ACACTCTCATCCGCTCAGTGGTATTGTGATATGCTGCACTTCTGTACCTT
CAGAGCTCCGTACAACCTTAGCGAAGAAGGCTGTGGATATGGGGGCTCGA
CATGTCCTAGACCTAACCTCCGATGTTACACATCTTATCTGTGCCGACCT
CACCACACCAAAATACAAGTACGTTGCGAAGATGAGAGCTGATGTGCGGG
TCATGGGTGTGGGGTGGGTGGATGCCATGTACGATTTATGGATTAATGGC
GAGGACATCAACCCTATAGATTTCAACGAGGAATACAAGTTCCCTACCTT
CCAGGGGTTGGCTATCTCGTTGACTGGTATTCAGGAGTTGAGCGAACGGA
AAAAGATCGAGGACATTGCGAGGTCGCACGGAGCTTCATACCATCCTGAC
CTGACAAAGTCGGTATCACACCTCATCGCTGCGATCTCCGAGGGGAAGAA
GTACGACTTTGCTAGGAATAATGGCATCAGGATTGTTACGATTGAATGGC
TGTACGACAGCTTAGAGCGAGGAATGGCGCTGGACGAGAGCTTCTACGAC
CGAGAGCTACCTCGGGAGATGATTGGCGTTGGTGCTAAACCATCGGCGAC
AGTAACCCCTGGGGGGAATGTCGAGGTCTCGGGAAAGCGCAAGATACGTC
AGAGAGCGGAGGATCTGCTGGGAAGCGGAAGCCAACACATCTGGAGTGAT
ATTCTGGGACAAGCCGCCAATCCGAAGCCGAAGAAACGGGACGAATGGGG
GGATGATCCGGGGGACGATGTGATCGTGCTGGACCATCCGCCACCAATGC
CCCAGGAAAGGAGGCCTGCCGAAGCTGCTGGGGGTAAAGCGAAGGGCATA
ATGTCTGCTGCTACCTTCTACATTCATGGTTTTAAGGATAAGCATGAAAA
AACAGTTCGTAGTGTATTGCTATCCTATGATGCTACGATAGTCTCAAAAA
TTGAAGATCTTGAATCATATCGGGAATCTTCAAGACTTATCATCATAGTT
TCTCACACCATTTCCAAACTGAATTGCCCTGAGTTTCCTGGTGCCGAGGT
TGTCACGGAATGGTGGCTCGAGACTTGTCTACATGAGTCCCGGTTTGCAG
AGCCATCCGAGCACTTTACAAATACACCGTTTGAAGAATTTCCCCTGGCA
GGGCTGGAAAGGGGAAACTTTCACGCTGTGCTCAGAAAAGAGCGAACCTT
ACTCATCTCCAACAGGCCGGCGGTTGGTGACAAATTCCAGTTTGCACTTC
GATACGATATTCCCGTGGTTTCGGATGATTGGCTGGAAGCATGCGTCAGG
GAGAGGGGGGCAGTAGCTTTTACAGATTACCTTATCCAGGGTGAGAGGTT
GGAGAGTCGAGAGCGCAGTGTGACTATTACGACTGGAGAGGGCGAGGCGA
AGAAGCGTGCACGATCAGAGACTCGGGGTGTAGCTGAGGATCCCAAAAGG
CTTCGACCGGCGGAGGACTCGAAGGCCTGATGCGCCCGGAAATGGTGGTA
TCGGAGCCAAAGCTCGCAGGGGGGTGAAGCGTGGCCGGGATGAGATCATT
GTAGATGATGTAGCTTGCTCTAATGAGAAGAAACAGCGTATTCTCCACGG
CTGCATCATTGGTATTAGCTCGGGATTAAAGGATCGTCGTGCTAGCTTGG
ATTCGATTGCCAAATCTATGGGTGCTGATGTAGTGGGCTCCTTCTCTTCA
GAAGACCTAACTCTAATCACTCATTTTATTGATACGTTTGAGGTGACCCG
GAAGTCGACCAAGGATTTTGAAGCGGCTAGGGCAATTGACAATTGTCACA
TAGTCTCCACCGATTGGCTGTATAGTAGCGAAAAACATGGGAGGAGAGCT
GATGAGAAGGCATACTCCCTGATACGACCACG

Sequences in the Contig:

SY0AAA21YE21FM1 SY0AAA39YN16FM1 SY0AAA40YO20FM1
SY0AAA61YI18FM1 SY0AAC24YH04FM1 SY0AAC59YI22FM1
SY0AAD42YA15FM1