Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4084
Length(NT) : 930
Best Gene Model Blast : Link to GSTUMT00005326001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_01022
Accession: ref|XP_001598933.1| Score: 467 E_value: 7e-45
KEGG Definition: conserved hypothetical protein; K02540 minichromosome maintenance protein 2
Accession: mgr:MGG_08122 Score: 448 E_value: 6e-43
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0477 Score: 367 E_value: 7e-36
PFAM Definition: No Hit Found
Swissprot: P29469|MCM2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0031261 = Cellular component: DNA replication preinitiation complex
GO:0042555 = Cellular component: MCM complex
GO:0005656 = Cellular component: pre-replicative complex
GO:0003682 = Molecular function: chromatin binding
GO:0003688 = Molecular function: DNA replication origin binding
GO:0005515 = Molecular function: protein binding
GO:0006271 = Biological process: DNA strand elongation during DNA replication
GO:0006267 = Biological process: pre-replicative complex assembly
GO:0000084 = Biological process: S phase of mitotic cell cycle

Sequence:
>Contig4084
TTGGGTATCACCTGAATCCTGCACTCCTCTGACCTCCACCAAAAACTCTA
CGCTTTATTATCAACAAACCGGTTCTTTGATAGTTGAGTGCCTTCAAACC
TACAACCCTAGTAATTTCAGCATTGGAATTGCATCTTTGCCTCTTTCACT
CCTCACTGTGAAAGACAATGTCGTCCCCAGCCCCGCAGTCTTCTCCTCCT
CCAGAAGTCAACCCCAGAAAACGTGGCTTAGAAGATGATGATGAAGAGAT
GGGAGATAATGGGGTTCCTTCAAGCCCTCCCGGTGGCTTCTTACCCTCGA
CACCCGGCTTCCGTTCCTCCCCCCCACTTATGGATGATGATGACGATGAT
GAACTCGACGAGCATGATGGGATCCAAGACCTGGAGGATATGGAGGAAGA
AATGGATGGTGAGGATCTAATGCAGGATATGGAGCGGGACTACACCCAAA
ACCTCGTTCTGGATCAATACGAAACCACCAACATCGATGATGAAGGCGAA
TATGATGAACTCAGCGCCGCTGAAGTACGCCGGCTTAACAAACAAATGGA
TATGCGAGATAATATGGCCCGACGCATGCCTAGTGCCTTCTACAGTATTG
ACGAGGAAGACGATGAGATGGATCTATCTAATCAAGTTCGCCGCCGTAGG
CATCATTTCGATGAGGATCCCCAGGATGATATGGACAATGTGATGGATGA
GGAGCTCTCATTGGAACAACTCGGTGACATTAAAGCTTCCAGTATTGCCG
ATTGGCTCACGGTTCCAAATATATACCGCAGTGTGGCTGTGCATTTCAAG
AATTTCTTGCTTGAATATACGGATGATGTCGGCTCTTCTGTGTACGGTAA
CCGTATCAGGACTCTTGGTGAAATCAATTCCGAATCCTTAGAGATCTCAT
TCCAGCATCTTGCAGAGTCCAAGGCTACGC

Sequences in the Contig:

SY0AAC24YG22FM1 SY0AAC51YM06FM1 SY0AAC54YM08FM1
SY0AAD27YG03FM1