Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4083
Length(NT) : 653
Best Gene Model Blast : Link to GSTUMT00004688001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_02224
Accession: ref|XP_001559060.1| Score: 142 E_value: 2e-07
KEGG Definition: hypothetical protein
Accession: ncr:NCU09222.1 Score: 127 E_value: 5e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4083
TTGGAACCAAACCAGACCAGCCGACCGACCGTGTGCAGCAGGACCGTACC
TACATCCACTCGTCCATCCAGGCACGGGGCCCCACACGCACCACCATTAA
CCACCACATAACCACCAAACAGAACCCGATCTTATAAACAAGCATGTTAT
CCCAAACATCCCGCACCCTCCTACTCCGCACCCCGCGCCTCCGAACATTC
ACCGCCTCGAGTATCTACCGCCAAGCTGCGACTTCTGCCACTGCTACTCC
CGCGGCAATTCCAAAAAAGAGACCGGTTGGGGCTTTCAGGGGGGGGCTGT
TTGGATTTCTTCTTGGATCAACGTTTTCTGCTGGCACCGCCTACTTTTAC
TGGCTTGAGGAGTATAGGGTTTCTAATGAGCTTTTGACCGAGGATGTTGA
GGCTTTGAGGAATTCGATTCAGAGGGTGGAAGCTTATGTTAGACGGTTGG
AGGAGAATATGGAGATCCAGAAGAGTGCTCCTGGTAAGGGAAAAAAGTGA
TGGACTGGTGGGTGGATAAGAGGTTGTATGGACGGGGGATGAGTGGGTAG
GGGGTTATACGATTTTTTGTGATTGCTTGAGCGGACGAGCGTTGGGGGAG
TTGGACTGTAATTAACCAAAAATGGGGATCCGCGGGTTTTTATATTATTG
GGG

Sequences in the Contig:

SY0AAC24YG11FM1 SY0AAD42YC20FM1 SY0AAD60YE12FM1