Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4082
Length(NT) : 1020
Best Gene Model Blast : Link to GSTUMT00002874001 E-value : 0.0
Numbers of ESTs : 54

Blast Results:

Nr Definition: hypothetical protein NCU03639
Accession: ref|XP_961366.1| Score: 525 E_value: 2e-51
KEGG Definition: hypothetical protein ( (AL513444) probable triacylglycerol lipase precursor [Neurospora crassa OR74A] )
Accession: ncr:NCU03639.1 Score: 525 E_value: 8e-52
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG4569 Score: 312 E_value: 2e-29
PFAM Definition: Lipase_3, Lipase (class 3)..
Pfam Number: pfam01764 Score: 328 E_value: 3e-31
Swissprot: O59952|LIP_THELA

Sequence:
>Contig4082
TTGGAGACTACCATTGGTTTTTGTTTAGCTGGGGCGTCTCACACAATTTC
TACACATTCTCTTTCTCTCTTTCCTTTACGATGCTTCCAAGTGCCATACT
CACGCTGCTGGCAGTTTTTGCTGCCGGGGTTGTGGGTTCCCCAACCGGAA
TTCCACAGGACGACGTAGACCGGGATCGTACTATTGAAGAACTCTTGGCC
ATGGACGCTGACCTCGTTGAGAATGATATCGAGACTTTTTCACCCAAGGC
CAGTGCTCGTACTATCAGCGAGTCAGAACTAGCCACAGTGTACTATTACG
CTGAATTCGCAGCCGCAGCGTACTGTGATCCTGACCATGTTCCCGGAACG
GAAGCAAGCTGCAAGAACAACATCTGCCCCCAGGTTACCGCGAATAGCGT
TACCACCATCATTGAATTCGCAGACACTACTTCCTCCGACACAACCGGCA
TAGTGGCCCGCGACGACACCAGACGAACTATAACCGTTTCCTACCGCGGC
ACACAGTCCTTAGGGAACTGGTTCGCGAACGTCCAGATCCGCTGGAGTGA
TGCTTCGGTTTACTGCTCAAGCTGCAAGCTCCACACCGGTTTCTACAATG
CATTCAGAGACGCGTTCCCACCCATCCTCGCATCAATAAACTCGCTGCGC
GCCCAGTACCCTTCCTATAAGCTCGTTGTCACAGGACATTCTTTCGGCGG
CGCGCTGGCTACCATCACCGCTACGGAGTTCAGGAGATTGGGGTATACCA
CGGAGCTGTACACTTATGGTGCTCCCAGGGTCGGCAATGATAAGTTTTGC
TTGTTTGTTAGCCAAAGTTCGGGGAATTATAGGGTTACGCATTTGAATGA
TCCTGTACCGAGATTGCCGCCTGTGGCTCTGGGATACTATCATATCTCCA
CGGAGTACTGGATTTCCCGCGGGGACACCAACATCAAGGCCGGCGACGTA
GAGATCTACGAAGGCATCTTGAACACCGGAGGAAACACGGGGCAAAGCTT
TATTCCCCCCAATATCACTG

Sequences in the Contig:

SY0AAC12YJ18FM1 SY0AAC19YN07FM1 SY0AAC20YB24FM1
SY0AAC24YG10FM1 SY0AAC26YB15FM1 SY0AAC28YA21FM1
SY0AAC33YB10FM1 SY0AAC33YN14FM1 SY0AAC36YG20FM1
SY0AAC36YI23FM1 SY0AAC38YL09FM1 SY0AAC40YH06FM1
SY0AAC41YE12FM1 SY0AAC42YF06FM1 SY0AAC42YK23FM1
SY0AAC45YM07FM1 SY0AAC46YA09FM1 SY0AAC49YI24FM1
SY0AAC4YE15FM1 SY0AAC4YN16FM1 SY0AAC50YK12FM1
SY0AAC53YN14FM1 SY0AAC55YP18FM2 SY0AAC56YC20FM1
SY0AAC59YE04FM1 SY0AAC59YJ10FM1 SY0AAC60YI06FM1
SY0AAD10YC13FM1 SY0AAD13YE08FM1 SY0AAD16YJ24FM1
SY0AAD18YP24FM1 SY0AAD24YG23FM1 SY0AAD24YL16FM1
SY0AAD25YD05FM1 SY0AAD27YO21FM1 SY0AAD27YP05FM1
SY0AAD29YP05FM1 SY0AAD33YE15FM1 SY0AAD34YJ05FM1
SY0AAD38YE03FM1 SY0AAD39YH17FM1 SY0AAD39YP02FM1
SY0AAD40YC18FM1 SY0AAD41YK08FM1 SY0AAD41YN20FM1
SY0AAD43YG18FM1 SY0AAD49YD11FM1 SY0AAD4YB06FM1
SY0AAD50YC15FM1 SY0AAD52YL09FM1 SY0AAD56YC15FM1
SY0AAD7YG20FM1 SY0AAD8YM20FM1 SY0AAD9YK12FM1