Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4081
Length(NT) : 839
Best Gene Model Blast : Link to GSTUMT00007995001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_361990.1| Score: 817 E_value: 2e-85
KEGG Definition: conserved hypothetical protein [EC:2.1.2.3 3.5.4.10]; K00602 phosphoribosylaminoimidazolecarboxamide formyltransferase; K01492 IMP cyclohydrolase
Accession: mgr:MGG_04435 Score: 817 E_value: 8e-86
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG2555 Score: 810 E_value: 3e-87
PFAM Definition: AICARFT_IMPCHas, AICARFT/IMPCHase bienzyme. This is a family of bifunctional enzymes catalysing the last two steps in de novo purine biosynthesis. The bifunctional enzyme is found in both prokaryotes and eukaryotes. The second last step is catalysed by 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase EC:2.1.2.3 (AICARFT), this enzyme catalyses the formylation of AICAR with 10-formyl-tetrahydrofolate to yield FAICAR and tetrahydrofolate. The last step is catalysed by IMP (Inosine monophosphate) cyclohydrolase EC:3.5.4.10 (IMPCHase), cyclizing FAICAR (5-formylaminoimidazole-4-carboxamide ribonucleotide) to IMP..
Pfam Number: pfam01808 Score: 218 E_value: 1e-18
Swissprot: P38009|PUR92_YEAST
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0003937 = Molecular function: IMP cyclohydrolase activity
GO:0004643 = Molecular function: phosphoribosylaminoimidazolecarboxamide formyltransferase activity
GO:0005515 = Molecular function: protein binding
GO:0006189 = Biological process: 'de novo' IMP biosynthetic process

Sequence:
>Contig4081
TTGGGTCCAATACCCGTACATTAATTCGGTGTTTGTAACCTCGCCTCGAG
TTACTTTTCTGCTCCTCTGCCCCTTCATGCCAGCCCCACGTTTGAAACAA
AACAAAAACCCCCAGGCCCACAAGCACCCTTGAACTTCCGGTGCTCGTGC
CTGATAAAATCACTCTCCGATTCCCTTCGCACCTCTTCGGTTCACCGCAC
GAGAGAAGATCATTGAAAGTGCATCATGTCTTCTTCGCAAAAGACAGCAA
TCCTTTCCGTCTATAACAAGACCGGACTATTGGATCTCGCCAACGGCCTG
GCCCTGCAAGGGATTAGACTTTTGGCATCCGGGGGCACAGCCAAGTTGAT
TAGGGAGGCCGGAATTGGGGTTGAGGATGTGAGCAGCATTACCCATGCCC
CGGAAATGCTTGCCGGAAGGGTTAAGACTCTTCACCCCGCTGTCCATGCA
GGTATTCTTGCGCGGGACCTCGAGTCCGACGAGAAGGACCTTGCGGAGCA
AAACATCGATAAGGTCGACTACGTCGTCTGCAATTTGTACCCCTTCAAAG
ACACAATTGCCAAGGTTAACGTTACAATTGCGGAGGCCATTGAGGAGATC
GATATTGGTGGTGTAACGCTCTTGCGTGCCGCGGCCAAGAACCACTCCCG
TGTCACAATCCTTTCGGACCCAGCCGACTACCCTTCCTTCTTGGAGGAGC
TGCGGAGTGGCGAGGTTTCGGAGGCTTCTAGAAAACTGTATGCCTTGAAA
GCCTTTGAGCATACTGCCGATTATGACGCCACAATTGCCGAGTTCTTCCG
TAAGAGATATGCCGGGGACGGCGTCCAGCACCTTACCCT

Sequences in the Contig:

SY0AAA10YI05FM1 SY0AAA18YI07FM1 SY0AAB35YK12FM1
SY0AAB51YP06FM1 SY0AAC24YF05FM1 SY0AAC30YB13FM1
SY0AAC36YB22FM1 SY0AAC45YH05FM1 SY0AAD35YG16FM1