Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig408
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00007162001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An12g00850
Accession: ref|XP_001395174.1| Score: 106 E_value: 2e-08
KEGG Definition: hypothetical protein
Accession: ang:An12g00850 Score: 106 E_value: 1e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig408
TTGGCCCCCCTCCCACGAGGAGGATAGGCTTCAGGATCACCAAAACTTCG
TGCTCTTCTATTAATATTCTTCCCTAACTGAAAACTATCCATACAAACAT
CAAAGAATACACATTCGGCTCCAGCATCGTGAAAACAAAGCTTCTTGCAA
TTCCACAATCAGTCGATAAGATGGGCAATTTTTTCTCAAGCAATTCTTCT
GAGGCCCAGCCCTCAACGCAATGCAATATTGCCGGTGACTTTAACGGTAA
TAGAGGTGATGGCAATCAATTCAACTGCGGTAACATCATCAACCATTTCC
ACGGCGCAACGAACTCGTCCGAGGGGCAGGCCAAAATTTTACAATGCTTA
CACAAGTCGGTGTACGAGTCGCATCGACGTCGGGTTCGTGAGCCAGTCGA
TGGAACGTGCACCTGGGTTACGGAGCACCCAAAGTATATGGAGTGGATGG
GGAAAAAGCTGCGGGTCTCCTCTGGCTATCGGCGGACCCGGGTTACGGAA
AATCTGCCATGGCTTCATTCCTCGTGGGTCATCTGAAAATGCAAACCGGC
GCCATCGTCTGCTACTTTTTTTT

Sequences in the Contig:

SY0AAA23YA12FM1 SY0AAA24YA12FM1 SY0AAA24YA12FM2