Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4079
Length(NT) : 1775
Best Gene Model Blast : Link to GSTUMT00007773001 E-value : 0.0
Numbers of ESTs : 28

Blast Results:

Nr Definition: hypothetical protein SS1G_01136
Accession: ref|XP_001596944.1| Score: 1118 E_value: 1e-120
KEGG Definition: transcription initiation protein; K03124 transcription initiation factor TFIIB
Accession: afm:AFUA_3G10620 Score: 1078 E_value: 1e-115
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1597 Score: 869 E_value: 9e-94
PFAM Definition: TFIIB, Transcription factor TFIIB repeat..
Pfam Number: pfam00382 Score: 185 E_value: 2e-14
Swissprot: O13749|TF2B_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0030528 = Molecular function: transcription regulator activity
GO:0006367 = Biological process: transcription initiation from RNA polymerase II promoter

Sequence:
>Contig4079
TTGGCCGCGATCTCACCAAAACCTTCACCCCTCCCGACCTCCACCGCCTT
ATACTGTGCCTCACAGTATTCAACGGCAGACGCTCAGGTCTGCTTCCCAG
TCTTTACCGAAGCGAAATTTTGTACGGAGGATCCGCTACTGCAGAGAGAG
AACAATAGGGCAGCGCGGGGGGATTCCGGTCGGCCGAAAATTTGGTCAAC
GGACCATTCGAACCACCGCTCTCCTGCCCCCATCTCGACCGCTTTCATCT
TTCGGACCGTCCAATATCGTCTTTGAGCGAGCAAACTCAAAAATCCTCCG
TCATGACTATGCCGCCACCCGAGAAGCCATGGGAGGCCAATCATAATGTC
TCTGTAATGTGTCCCGATTGTCGCGAGGTACCTGCCAACATTGTAGAGGA
ATTTTCATCTGGGGATATGGTTTGCGGCTCTTGTGGATTGGTGCTCGGTG
ACCGTATTGTCGATACTCGATCTGAATGGCGCACCTTCTCGAACGACGAT
CAGGCTGGCGATGATCCTTCCCGTGTCGGAGATGCGGCGAACCCCTTCTT
GAACGGTGCTCAGTTGGAGACCACAATCTCGTACACTCCAGGAGGTGCTG
GAAGGGAGCTTCACAGAGCTCAGAACAAGACCGCTGGTGATAAGTCCACC
AAAGGGCTTCTGGCTGCGTACAAGGAGATTGGTGCGTTTTGTGACTCTAT
AAATATCCAGAAGGTCGTCTCCGATGCGGCGAAGCAGCTTTTCAAGATCG
TGGATGATCACAAAGCCTTCAAAGGGAAACCTCAAGAAGCCATTATCGCC
GGATGCATCTTTATCGCCTGCCGTCAGTGTCAAGTTCCTCGAACCTTCCG
CGAGATCTTCGCTCTGACGAAGGTTCCCAAGAAGGAAATTGGTCGTGTCT
TCAAGGCATTGGAGAAGTTCTTCGCGGCCCAGGATAGCAAGAAGATGGAC
GAGATCACCAAGTCGGGCGGTATTGTGGACGATAGTCAGCAGTACAAGAC
TACAAGCTCTACCAAGGCCACCGAACTTATGATTCGTTATTGCAACAATC
TGAACCTCACTCAGAACTGCACTACTATCGCCCAGGAACTCGCAGACCGT
GCTGCCACCATCGGTACCCTTGCTGGGAGATCTCCTATTTCTAGCGCTGC
GGCTTGCATTTACATGGTTTCCTATCTCATGAAACAGCCCAAGACTGCGA
AAGAGATTTCGACAATCGCGGGTGTCAGCGATGGGACGATTCGTAATGCA
TACAAGCATCTATACACCGATAGGAATAAACTGATTGACCCTAAATGGGT
CGAGAATGGTAAGGGGGATATTAGTGCCTTGCCGTCGTCATAGGGGGCCG
TTGGCAGCTAGTCTTAAAGCCTGAGCGCCTCAAGGCTCTGCTTGGGTCGG
CTCAGTGGTCTATCCCTTTAACTATTTTAACAATTTGTAACCCCTTGGCT
TGTTTTTATGTTACCTCCTTGTTCCTCGTACCTTCTAGCTTTTTAAACTG
TTCTTCATTCTACATGATAGACCGTGACCCCTTTTGGGGTTTCGATTCGG
GCGGCGTTAATCTCTGTATGGTGAGGTGGTGGTTTTCCATTACAAAAGCA
AAAGCTTTCCATTGTCATTATCCATGTGCTCAGTTTGTTTTGCTATCTTT
CGTTTTTCATCTCTTTTAAGGTCGGTGCGTGACAAGAGACAGATATCATA
CCAGTAATGCTTTTACGAAGTGAGGGGTCTGTAAGTTATCATAATAGTAC
GAGACCACATGTTTTTTGCTCCTAG

Sequences in the Contig:

SY0AAA20YO02FM1 SY0AAA31YG22FM1 SY0AAA31YG22RM1
SY0AAA32YP09FM1 SY0AAA32YP09RM1 SY0AAA35YL08FM1
SY0AAA37YI24FM1 SY0AAA45YO21FM1 SY0AAA56YB15FM1
SY0AAB18YJ21FM1 SY0AAB18YM08FM1 SY0AAB20YL17FM1
SY0AAB23YN06FM1 SY0AAB2YO24FM1 SY0AAB33YO01FM1
SY0AAB3YK06FM1 SY0AAB40YM01FM1 SY0AAB42YI05FM1
SY0AAB58YE21FM1 SY0AAC24YE22FM1 SY0AAC27YF01FM1
SY0AAC30YO19FM1 SY0AAC36YF07FM1 SY0AAC38YB23FM1
SY0AAC45YA13FM1 SY0AAC45YO10FM1 SY0AAC48YH22FM1
SY0AAD34YP20FM1