Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4076
Length(NT) : 1842
Best Gene Model Blast : Link to GSTUMT00010515001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: proteasome regulatory particle subunit (RpnC), putative
Accession: ref|XP_001270630.1| Score: 1347 E_value: 1e-146
KEGG Definition: 26S proteasome regulatory complex, subunit RPN3/PSMD3; K03033 26S proteasome regulatory subunit N3
Accession: aor:AO090020000084 Score: 1343 E_value: 1e-146
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2581 Score: 1293 E_value: 1e-143
PFAM Definition: Rpn3_C, Proteasome regulatory subunit C-terminal. This eukaryotic domain is found at the C-terminus of 26S proteasome regulatory subunits such as the non-ATPase Rpn3 subunit which is essential for proteasomal function. It occurs together with the PCI/PINT domain (pfam01399)..
Pfam Number: pfam08375 Score: 263 E_value: 2e-23
Swissprot: O42897|RPN3_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0043161 = Biological process: proteasomal ubiquitin-dependent protein catabolic process
GO:0051726 = Biological process: regulation of cell cycle

Sequence:
>Contig4076
TTGGGGAGAAGCCTGGAGATGAAGACGTGGATATGAGCGATGGGAAGGAG
GGAGATAGAAAAGAGGAAGACCCCGTTGTCGTTGCAATAAATGGTAAGAA
TCTTATCTCTTTCTCCTTGGGGTGCGAGCGATGGATCTGATGCGGTGCTT
TAGAAATTAAGGAAAACTTTACTCTGCTCGAGAGAGCTGTCTCCCTGTTT
GATGCCCGATTTACCCTTCGTGTCTTGCGTTCCCTGTCATCTCTACGCCG
ACGTCTGAACCCCGAGATTCTCAGCAAAGTTGTTGCCGAGACATATCCTG
GAGATCATCCCTCGTCTCGTAGGCTTACCGCGGCTATCGGGTCTAGCGCG
TCTGGAATGGACCTTGATAGTCCTTCTGAAGGATCAAAGGATGGCGGGGT
TCTATTGCCGGAAATTGATATCTACCTTCACTTACTTGTGCAGATTTATC
TCTTGGACCAGAAGAATCTGGAAACGGGCGCAAGTTTCTCCACCGAGCTG
GTTCAGATAATACATTCGCTCAATCGTCGAACGCTTGACTCCTTGGCTGC
CAAGGTGTACTTCTATTATTCTCGTGTACACGAGCTTCTTCCTCCTCCTG
CCATCACCGAAATTCGTCCGCAACTTCTTGCCTCTTTACGAACTGCTACC
TTACGAAAAGATATTGACACACAAGCCACCCTGATTACGCTTCTCCTGCG
TAATTACCTCCAAACGTCACATATCACTCAGGCCGATCATCTCGTTTCAA
AGACTCTGTTTCCTGAGTCTGCGGCCAATAACCTCATTGCGCGCTACCAA
TACTATCTTGGCCGTATTCGTGCTATTCAGCTTGACTACACCGCCGCGCA
CAACGAGCTCGTGGGAGCTATCCGCAAAGCTCCCCAGACTGCCGCTGCCG
CCGGATTCGTCCAGGCTGCCAACAAGCTCAATATTATCGTTGAGCTTCTC
ATGGGGGATATTCCGGAACGGTCCATCTTCCGTGAACCTAGACTTGAAAA
GTCTCTGCACGCGTACTTTTTGCTCGTGCAAGCTGTTCGGATCGGAGAAC
TCGATTCTTTCTTTGACACGCTCAACACGCACGCTGAGACGTTCAAGAAA
GATGGCACATATTCCCTTATTCTCCGTCTGCGTCAGAACGTCATCAAGAC
TGGTATCCGTATGATGAGTTTGAGTTATTCAAAGATCTCACTGAGGGATA
TTTGCGTCAGACTTAGATTAGACAGTGAGGAGAGTGCTGAGTATATCGTT
GCTAAGGCCATTCGAGATGGCGTTATCGAGGCCACTTTGAACCATGAGAA
GGGTTATATGCAGAGCAAGGAGTTATTGGACGTTTATGCAACTCAGGAGC
CTCAGGAGGCCTTCCACGAGAGGATCATGTTCTGTATGAGCTTACATAAC
GATAGCGTTAAGGCTATGAGGTTCCCCATGAATCAACACCGGCTTGAACT
TAAGAACGCTCAGGAGGCCAGGGAGCGAGAGAGGGAGTTGGCCAAGGAGA
TTCAAGATGGAGATATTGACGATGATGATGCGGGTGGTGAGTTTGAGGGA
ATGTAGATCGCTTTGCTCCGTTGCACACTTTGTCGCATAAAGCAAGGGAT
GTTGGGGAAACTCATGTAAAAGGCATCGACAGGGGGTGGAGGGAGAGTGA
ACACCTGTGTGGGAGGGGCTGGGAACTTTTCTTTCATTTTTTACCTCGTC
TTGTTTCATTCCACAGCATTGCCCCGTATGTTTTCCTTTTAGACAATCAA
TACTCTCTTTCAGGTGGACATTGCCATGTACTCTATAGTTTATAGCTTGT
CGATAACATACCCTGCTCGATGTGAAGCTTATCATTGAACGT

Sequences in the Contig:

SY0AAA14YD15FM1 SY0AAA20YK02RM1 SY0AAB30YE19FM1
SY0AAC24YD01FM1 SY0AAD34YA19FM1 SY0AAD3YA22FM1
SY0AAD40YI23FM1 SY0AAD60YK09FM1