Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4075
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00007948001 E-value : 1e-116
Numbers of ESTs : 2

Blast Results:

Nr Definition: Ash2-trithorax family protein
Accession: ref|NP_596557.1| Score: 214 E_value: 8e-16
KEGG Definition: hypothetical protein
Accession: spo:SPBC13G1.08c Score: 214 E_value: 4e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O60070|ASH2_SCHPO
Gene Ontology:
GO:0000785 = Cellular component: chromatin
GO:0048188 = Cellular component: COMPASS complex
GO:0048189 = Cellular component: Lid2 complex
GO:0006338 = Biological process: chromatin remodeling
GO:0051568 = Biological process: histone H3-K4 methylation

Sequence:
>Contig4075
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTCTTTCAAAGCCCTTAGC
CTGAAACCACCCCAGCATTCGTCACCGCCCACGATGTCTGACATATCAAT
GCCTGATGCAGCTCCCTCTCCCTCACCAACAATTCCCCAAAAGCGTTCAG
TTGACATAGACCTCACAGAACAACCACGTCTAATGAAGCACAAAGAGAAG
GCAGCCCCTCGTGAGCCTCGCGAGAAGAAGGACTCTTGGAAGAAGAAGGA
GTCTTCGAATGTACCCTCGCCTATCGGTACCGGCTCGGGTAAGCACACTC
CTGGCGATGACTGGCCAGCTTTGATGCGCTTCCGTCTACCTCCCCCGCAA
GAGCAGGATTATTACGGACACCGCGCACCACCGGTAGCCCCGTGCCCGAT
ACCGGAGTTGGAGAATGAATTCTTTTCGGTGAATGATCATCCTATGAACC
GACGAGGTTTCCGTTACACGCCCTGCGAAGCAAGTCGCATGCTCCCCACT
GTCTCCTACCGAAATACAGAGTATGCCCCCTACGCTCCACGGATAAACTT
TGAAGACATGAACGCAGCGGTCCACGTAAATCGCAACGGTAGCGCTATCA
CAACCGCTAAGGGGTGGAGAATGGCACGCGCGAATGTCGGTGTTAGGGA

Sequences in the Contig:

SY0AAA37YA16FM1 SY0AAC24YB23FM1