Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4074
Length(NT) : 821
Best Gene Model Blast : Link to GSTUMT00010100001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: gb|EAU90514.1| Score: 163 E_value: 1e-09
KEGG Definition: hypothetical protein
Accession: uma:UM05400.1 Score: 163 E_value: 5e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4074
TTGGCGCACACCGCTATTCGATAATACAACCTCATCTAGCTTTACGACCT
ACGAACCTGCCATCCCAAATATAAAGATTCTACTTTAGCCACTACCGAGT
CCGCCCGCCATGTCCTCCAGACCTTTGAACCTGGGGGATTTCCCTGGTGA
GATCCTGGATCGTATCCTTGATTATGTCGGATACAAGGGAGCTGTTAACC
TCTCAAGGACATCGGTCTCGCTCATCCTCCCTCTTGTTATGCACGTGCAA
CTGAGCTAAAAATTCCTCAGAAAGGTTTCCACAACACCCTGTATAACGAA
GAGACCGGTTACTGGAAACGCGAGGCCCAGAGGGTCTTCAAGACTCCTCA
CGTCGATAGCCTTATCAACAAGGTTCCTTGGCGGTACCTCTTCCGGGGTA
TGGCTAAGGCCCGTGTGTATACCTGGGGCCAGGATACCGATGGAAAACTC
GGACATGATCGACCACTACCGGATCGTTACATGCGGTCTCCGTATTCAGT
GGCTATACCGTTCGAGATATTGGGGCTAAGAAACAAGTTTGTGGTGGACA
TGGTTGCTGGAGGTTGGAGCACGAGCTTCCTCACCTCGGATGGGCATGTC
TATATATCTGGCCGCCTGGGCAGTGAGCAAGGCTCCACTGCTGAGATCAG
ATTCCCCGAGCCAATTTTTCAACTCTCTGCCGGGCGTGGCCACCTTATTG
CACTGTCCAACAAGGGACGTGTATATACTTGCATAAATAAGTCACAGGGG
GCGCAACGTGTAGACTTTTGTGTTACGGTCAATGATTCTGATCCCGGGTA
TCTGACACCCGATAATGTTGG

Sequences in the Contig:

SY0AAC24YB15FM1 SY0AAC26YI09FM1 SY0AAD40YG16FM1