Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4073
Length(NT) : 679
Best Gene Model Blast : Link to GSTUMT00002136001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: electron transfer flavoprotein alpha-subunit, mitochondrial precursor
Accession: ref|XP_962674.2| Score: 595 E_value: 6e-60
KEGG Definition: hypothetical protein
Accession: ang:An07g02700 Score: 571 E_value: 2e-57
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG3954 Score: 546 E_value: 8e-57
PFAM Definition: ETF, Electron transfer flavoprotein domain. This family includes the homologous domain shared between the alpha and beta subunits of the electron transfer flavoprotein..
Pfam Number: pfam01012 Score: 325 E_value: 3e-31
Swissprot: P78790|ETFA_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig4073
TTGGCCACCACCAAACAAACTTTCAGCCATGTCTATTTGTGTCGCCCAGA
CAAGAGCTTCCCTGCTTCGATTACCTCATCAGTCCGCTCGTTCTACCGTC
CGCTCTCGTCCATTCACGCCCAGCCCACGACTTCTCAACACTCTTGCAGT
TCTCGAACACAAAGATGGAAAGGTTTCTTCTCAATCATTCCCGGTCGTCA
CCGCTGCTTCAAGATTTGGTGGGCCTGTCACTGTTTTTCTCGCAGGCTCA
GGTTCGAAGGAAGTATCAGAACAAGCTGCGAAACTCAATGGCGTCGAGAA
GGTAATTTACGCTTCAAACAGCGCCTACGACAAGGGATTACCCGAGAACT
TTGCACCCCTACTCGTAGAGAACATTAAGAGGGGACACTTTACACATGTC
GTCGGTTCCCACTCGGCATTTGGTAAAAACATTTTGCCACGGGCATCTGC
TCTGCTGGACATTCAACAGATTTCCGACTGTATTGAGATCAAGGACGAAA
ATACCTTTGTCCGACCCATCTATGCCGGTAATGCCATAGCAACAGTCAGG
TCTACCGACACAATCAAGATTGTCACTATCCGAGGAACTGCGTTCCCCCC
AGCGGAAGAGACATCAGATACAGCGACTATCGAGGAGGCGCCTATAGATC
CTAATGCAGAATGTACAACGGTTTGGGTG

Sequences in the Contig:

SY0AAC24YB08FM1 SY0AAC46YI23FM1