Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4072
Length(NT) : 2060
Best Gene Model Blast : Link to GSTUMT00002170001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_01338
Accession: ref|XP_001597144.1| Score: 1511 E_value: 1e-165
KEGG Definition: phosphatidylinositol 4-kinase
Accession: aor:AO090026000314 Score: 1460 E_value: 1e-160
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2381 Score: 210 E_value: 3e-17
PFAM Definition: No Hit Found
Swissprot: Q9UT42|YIPJ_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005794 = Cellular component: Golgi apparatus
GO:0005774 = Cellular component: vacuolar membrane

Sequence:
>Contig4072
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCGTGCTTGATACCCAATC
TTAGCTACATCTCTGAAGCTGCGGCTTGCCTTTTGGATCGGCAGTTGAAG
ACATTTCTTGTTCCTTATACAGATGTTGTCAAGCTGTCAAGCAAATCGTT
CCACTATGACTACTGGGATCGGCGAGCTTACTATAAGAAGCACAAGCCAT
TGCCATCTAAGGTTGGCAGTTTCCAAGTGTTTCTTAAGGGGTTTCAGGAT
GCAAACGTTTTTCTGCGAAAGCACCCATGGCCGGACCAGTTCAATTCATC
GTTTCGGACAGACTCTGCTCCTAGGAGGCGAGCGCCTTGGGTGTCTGCAT
GTAGACCTAGTGGCGCTGTCGATGATGACTCTGACGAAGAGTCTCACACA
CCATTGTCAGTGGATGACCCAGATAATCGCCGGTTTGTATGGACTGAGCA
GCTGCAGCAAAACTTTCGCGAGGAGCTTGAGAAGCTCGTAATTCTAGATT
ATATTATGCGGAACACAGATAGGGGTTTGGATAATTGGATGATCAGGGTT
AATTGGCAGACATCGGAGGTTACCGTGGTGTCTCAGCCAACTCAACTCAA
CGGGGTGTCTTCGTCCCCACAAAACGGTAGTCTTGATCCGAGCACGGTTG
GGTTGAACACCGTACGTTCCGCATCCCCCATGTATCGAGTGCAGGAACCA
ATGGTTGCAAGCTCAAGGTCCGAAACCCCTCAACCAGGTGCCGGCGCTGC
GTTGACTATCGGTGCCATTGACAACTCGTTGGCCTTCCCTTGGAAGCATC
CTGATCAATGGAGGAGCTTTCCTTTTGGATGGCTCTTCCTCCCGGTGTCT
CTCATCGGTCAGCCCTTCTCCCAGAAGACCAGGGATCACTTTCTACCAAT
CTTGACATCTGCGAAATGGTGGGCGGAAACACAAACCCTACTTCGTCGAT
TGTTTGAGCAAGACTCAGACTTCAAGGAGAGAATGTTCCAGAAACAGATC
GCAGTGTTGAAGGGTCAGGCGTTCAATGTAGTCGAAACCTTGAAAACACC
TGACCAGGGTCCTCTAGAATTGACGAGGAGAACGAGGGTCCACGTTTGGG
ATGATGAAATGGAAGTTCCGGTTGCCGTTCCACTACGTGTGCCTACCACG
TCTGATGCTAGACATCGGCGGGGGCATGACCTTGAACGAGGTTTCAACGA
ACAGGTAGAGATGGATATAGGGGCTGCTGCCTCGTCGGCTCCTCTGTCTC
GAGAGATCGATATACTAGGACTAGGGCTCTCGCCGCCACGTTACGAGATA
CCAAGTTCCGTGAGGTTGGGAATATCTAGAACCACTAGTATTGGATCTAG
TAACGGCGGCGAGCTCAGCGATCAACAAAGTGCTCTTATTCCTAGTTCAC
CTCAGTCCCCTGCGGAACCCGCTGTCTCCAAATCACCAACAGGACGCGCA
GGTATCCGTAGTGGTGCTCCGGGCTCCCCAAGACCGCAAAGACTGGATTA
CAAGAGCTTCGATGCTGGCAGCCGAAATGGGCCGTCTAGGAGGAAGGATG
CTCCGGGCCTTCTCGACCCTCGAAGGCGGAGGTTCTCGCTGACAGGTGGC
CTTGGCGGAGGTCCCCCGCGGAACGTATACAACGATGATGATGCAGAAGG
CGATTTGGGATACTCGGCTGTTGGTGGCAGCGAAAGTGCGCAGAGGAAGG
TCATCGTCGAGAGGTTAGAGGCCGTCAAGTCCAGGAATCCGGTATTCACT
TGGTGTTAGAAAAAGGAAAAGAAAAGATTTGCATCGGAGTAGTTTGGGTT
TTGTGTTCTTCCTTTCTCTTTCTCTCTTTCCCTAAAGACCGGATCGGTTT
TTTGTTTTATTGAATCAAACACAGGGCCGTATTTGAGTTATTTTTCCACC
TTCTCTCCTTTCCCTCGTGCTTGTCTTGTCTCCTTTATTTTTCAAGCTTG
AAGCACGGCACGCCGGTATTTGGTTTGGCGAGAGCGAACGTGCGAAATGC
GAGGAAAAAAAAGAAAGGAAAGAAGGAACGTGGCACTGGGTATGTCTCGG
CACAGTACTG

Sequences in the Contig:

SY0AAB54YL02FM1 SY0AAC14YO02FM1 SY0AAC24YA22FM1
SY0AAD53YL13FM1