Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4071
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00006594001 E-value : 1e-116
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4071
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTGTGATATGAATCGGAATTCTAGTTTGTTGCCAACGTTGAGT
AGACTTACGGTACTATTACCGCTTCTTTGGAGTCGGTGATTCTGTGGACT
ATCACTTTTTTTCAAGTGACTGCAAGAAACGTCGGAAGGTTTCGTGCAGC
GCGGCGAAAAAAAAAAAACAATCAGGGAAAAATGAAACAACTACAGTACC
AATGGAACCTGGCAAGAAAGAACAATACCCTGCACCTCTGGACAACACCC
TCACCCAACCGGCTTTGATCCCGCATCCTCGGAAACGCGGCTACCCGGCT
CCGCAAAATACATTTACGCACGTGAGATTCGCTGTGGAAGCTCAGCTGAA
TCCGGGGCTTGATATGTACAGAAAAGGATACAAACCTATTAGAGATGGTG
TGTCCGGATAAGTACCAGGGTAGGGGAAGATAGCTGTCTCTCTCTTCGTG
TCGCCACATTTCCGATCTCCGGGGATGTAGTGGATTGTGGGGGAGACTGG
CAGGGGGCCGCTCAAGAGGGATAAGTTACTAAAGGTTGTTGAGCGAAGGC
GCATGGG

Sequences in the Contig:

SY0AAC24YA07FM1 SY0AAC35YC08FM1