Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4070
Length(NT) : 1861
Best Gene Model Blast : Link to GSTUMT00006746001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: vacuolar transporter chaperone 4
Accession: ref|XP_001218496.1| Score: 1906 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An12g04710 Score: 1891 E_value: 0.0
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1161 Score: 797 E_value: 2e-85
PFAM Definition: VTC, VTC domain. This presumed domain is found in the yeast vacuolar transport chaperone proteins VTC2, VTC3 and VTC4. This domain is also found in a variety of bacterial proteins..
Pfam Number: pfam09359 Score: 710 E_value: 3e-75
Swissprot: P47075|VTC4_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0031310 = Cellular component: intrinsic to vacuolar membrane
GO:0033254 = Cellular component: vacuolar transporter chaperone complex
GO:0016237 = Biological process: microautophagy
GO:0007034 = Biological process: vacuolar transport
GO:0042144 = Biological process: vacuole fusion, non-autophagic

Sequence:
>Contig4070
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGTTACCGGACACTTGTACC
AATCTCCTCGACCCACGCTTTGGATAGGGGAATTGATTGTTTGGGGCTAA
GGGTCATCGCTTTTGTTCTTATATATTTTCTCTTATCCGTGAGCTTTTCT
TCGCCCGGGTTCTCTCCCACTTCAATTGGGGTCGGAATCGAGGAAAAGGG
CTGTTGGTCAGCTCGTGGGTTTTTTTTTACATTATGAAGTTCGGTCAACA
GCTTCGGACGTCCCTGATCAAAGATTACTACTACTACTACATTTCCTACG
ATGACTTGAAATCCGAGCTCAAGTCCCGCCTCTACCCGCCGGGCACCAAC
CCCGCCGTCTCCTCGCCAAGGAAGTGGACGGAAGATGACGAGAAGGCCTT
TGTGGAGGTCCTGGAGACAGAACTGGACAAGGTCTTCACCTTCCAAAAGG
TCAAGTCCGGGGAGATCGTTCGAAGGATTAAGGTTTCCGAGAAGGAGGTC
GAGGACGTCGTCAAGCAGCTGGACTCGCGACCCCCCGCGCGCAGGGAGAA
TCAGGCCGTAGCGGGCGTTGGCGAGGGGAGGGCAGGGGAGGCTCCGACCG
GTCCGACTGAGGAGGACTTTGAGATGCTCGAGGAGGACCTGAGCGATATC
ATCGCCGATGTTCACGACTTGGCCAAGTTCACGCAATTGAATTATACGGG
GTTTCAGAAGATTATCAAGAAGCATGATAAACAAACTGGGTGGCCACTTA
GGCCGATTTTCTCGGCAAGACTCAATGCAAAGCCGTTCTTTAAGGACAAC
TACGACGCTTTTATCGTTAAGCTTTCAAAGTTGTACGATCTGGTGAGGAC
GAGGGGGAACCCGACTCAGGGTGATAGTAGCGCCGGAGGCTCTCAACAGA
ACTTTATTAGACAGACAACAAAGTACTGGGTTCACCCGGATAATATCACG
GAGCTGAAATTGATCATTCTAAAGCATCTGCCGGTGCTCGTGTTCAACCC
GAATAAGGAGTTTGAAAAACAGGATTCCGCAATCTCCTCGATCTACTACG
ATAACCGGGATTTCGAACTCTACCTCGGCCGTCTACGCAAGGATGAGGGT
GCAGAGGCAGTTCGTCTTCGGTGGTACGGTGGGATGGACGTTTCGACCAT
TTTTGTGGAGCGCAAGACCCATCGTGAGGATTGGACTGGGGAGAAGAGTG
TCAAAGCGCGCTTTGCGCTGAAGGAAAAGAATGTCAATGCGTTCCTCAAG
GGCGAGTATACCGTTGGCCAGGCCTTTGAGAAGATGCGGAAGGAAGGGAA
GAAGAGCGTCAAGGAGATTGAAGCCTTGGAAGCTTTGGCGAGGGAAGTGC
AGTACACAACCATCACCAAGGAATTGACGCCCGCTGTGAGGTCGTTTTAC
AACCGTACTGCCTTCCAGTTACCAGGCGATGCCCGAGTGCGTATCTCGCT
TGATACCGAGCTGTCCTTGATTCGTGAGGATAATTGGGATGGGACAAAGC
GCTCTGGGGATAATTGGAGGCGAATGGATATTGGGATTGATTGGCCATTC
AATCAGCTTCCTGCTAAAGATATTGAACGTTTCCCATACGCCATTCTGGA
GGTCAAGCTGCAGACCCAAGCTGGTCAGGAACCTCCAGAGTGGGTTCGAG
AACTCACCTCCTCTCATCTTGTCGAGGCGGTCCCCAAATTCTCCAAGTTC
ATTCACGGGACGGCAACCCTGTTCCCTGACAAGATTGACTTACTTCCTTT
CTGGCTTCCCCAGATGCATATTGACATTAGGAAGCCCACAACCCATAAGT
TTGGAATTGAAAGGCCAAATCAGAGTGGTAGCGGTTCTTCCGATGATCCA
TTTGACTCTGA

Sequences in the Contig:

SY0AAC23YP05FM1 SY0AAC26YP22FM1 SY0AAC34YD01FM1
SY0AAC44YK09FM1 SY0AAD23YI02FM1 SY0AAD45YL09FM1
SY0AAD53YL22FM1 SY0AAD57YO07FM1