Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig407
Length(NT) : 472
Best Gene Model Blast : Link to GSTUMT00005882001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: sterol C-22 desaturase
Accession: dbj|BAC01140.1| Score: 638 E_value: 3e-65
KEGG Definition: hypothetical protein
Accession: fgr:FG01959.1 Score: 616 E_value: 4e-63
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P54781|ERG5_YEAST

Sequence:
>Contig407
TTGGTCGGAGTATCTTGCAAAGTGGAATAGCGGACCTCTCAGTTGCGTTT
CAGTCTTTCATAAATTTGTTGTCATCGCTTCAACTAGAGATTTAGCTCGC
AAGGTATTTAATTCCCCAGGGTATGTTAGCCCCTGCGTCGTAGATGTTGC
CAAGAAAATCCTTCGTCCTGAGAATTGGGTTTTCTTGGACGGCAGAGCGC
ACGTTGAGTATCGTAAGGGTCTCAATGGATTGTTCAGTCGTCAGGCTATG
GGCATGTATCTCCCTGGACAGGAGGAGATTTACGACGTTTACTTCAAGAA
GTGGTTGGAGCTTTCCAAGGAGGGAAAACCTATCCCCTTCATGTCCGAAT
TCCGTGACATCAACTGCGCCGTTTCCCTGAGAACCTTTGTTGGCCATTAT
ATTAGCGACGAGGCTGTTAAAGAGATCTCTGAGAATTACTACAAGATCAC
TGCCGCCCTCGAACTGGTCAAC

Sequences in the Contig:

SY0AAA23YA01FM1 SY0AAA24YA01FM1 SY0AAA24YA01FM2