Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4069
Length(NT) : 956
Best Gene Model Blast : Link to GSTUMT00008330001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 346 E_value: 8e-31
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 346 E_value: 4e-31
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig4069
TTGGCTACTAGCACCACATTAAAGCAACGGAAAACAGGAGATGTCTCACG
CTTTTAGCAATAACACCAACTCTTTCAATGTTTTCAATATATCAAACCAC
TTTCCCGTTGTTGGTGGTCGCTCCGAAATCCTAACCTGGCTATCCCCACT
CGAACCCAGCACAAGACATCAGGACGTTCGGGTCAGTCGCTTCGATAAAG
TGGGAGACTGGCTCCTGCAAACCCACGAGTTTCGAAGGTGGTGCGATAGT
ACTCACCAAGATGGATTTCATGATCCTGCCCTATATTGCTATGGCAACCC
AGGCGTGGGCAAGACTTACATCTGCTCGCTGGTAATAGATAGGTTATGCG
AGAAGGCAAGAGACCAAAATTTTGCGGTTGCTTGCTTCTACTTTGACTAT
GCAGCCCGGAATAAGCAGTCTCCCGCAAATATGCTCGGCTCCTTGTTGAA
ACAGATCGTCTGTGGTATGAAAACGGTCCCGCGAGAGATACTCCTAGCCT
TTGAGGAGCAGAAGAAGGTCATTGGTGGCCAGGGATTACGGGTCTCTGAA
ATTCTTAAAATGTTACAGACTGTAACGTTGTCAAAACGTACCTTCATATG
CGTTGACGCGATGGACGAATGTGTGGAAAATCATCGGCCCGATATTCTCG
ATTCACTTGCGCAACTCCTTCAGAGATCACCGGGCACTCGGTTGTTCGTG
ACAGGAAGGCGGCATGTCAGGGATGAGGTCCAGAAGTATCTTGCCGGGAA
AGCTACAATCTTATCCGTAAAACCCAACGAAGATGATGTCATAGGATTCA
TCCGCGCAAGATTGAGTAAGGATGGATTCCCCGACGCTATGGATAGTGCT
CTGGAGGCAGAGATAATCAAAAGCATTTCTGAGAATATGACGGAAACATT
TCTGCTCGTTTCTCTCAAAATTGAGGCTATCCTAGAAGAACCCACTATCT
TCCGGA

Sequences in the Contig:

SY0AAC17YA17FM1 SY0AAC23YO18FM1 SY0AAD29YH17FM1
SY0AAD6YF22FM1