Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4068
Length(NT) : 978
Best Gene Model Blast : Link to GSTUMT00003468001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4068
TTGGGCAACTTTTTTGTACAAAGTTGTCCCCCACGAAACGACAACACGAC
AGCACACGACAACACCTCCTTTGACCAGAGTATTCACGACTTGTTTAAAT
ACTTTTATCTTCCTGGCTGTTCCCCTCCTACCCTTTTCCCCCTGAATTGA
GACTCGAACATCTTGCGCTCTGGTATCTGCCACTACACACTCATCAATTC
ACCCATCTTCTCTCCGGTAGCCTAAGCCGGAATCACTAATCCCCAAACCC
CCTCCAAATTTTTTTTCCTTTTCTTCCGCGATAGAAGCAACCTCCCACCA
CCGCCGCTACCAACAAAAAAACAGAGGATTCACGCATCCACATACCTCAC
TCCAAGCACTTTATGAACAAAATGGACGAAATCCTCTTCCACGTCATGAA
CATCGCGCACAGCGCCACCAGCTACACAACAATGCTCAAGACCCACATGA
TCAGTCCCCTAAAACAGTACGCCGCCTCGCAGCCAGACCTGATGAACATC
GCCCTCCTCCTCGTGATCGTCTACCTCTCGCTTTCGATCCTTGGCATGGC
TAGTCGCTGGATCTACTCGGTCGTCATCACCACTCTGCGCCTGCTCCTTT
TTGTCGTCGTGATCGGTGGCGGGATATGGGTGTGGCAGCGCGGGCCGCAA
AAGTCCCAGAGCGATTTTCTCAAGGTCGTGGAGGTGGTCAGCGAGGGTGT
TAGTGCTGCCGCGGCCGGGAAGGGGCCAGGCGGTGGGCCAGGCGGAATGG
GAGGCGCTGGAGCCGGATTTGAGAGGCAGAGATACGAGTATTAGAGGTTA
CTCTTCGGTGATCCCGATGGGAATTGGAAGGCGGTTATAGAGGGTGGGGT
AGCTTTGTTTTTCTTATTTTTATTTTTCTACTATGCTAGCGCTGATGATG
ATTACGACGATGACTTGCTGAGCTCCTACTCACGGGTGAATTGGATGGAT
GGATGGATGGATGAGTGAGTGTGAGCAG

Sequences in the Contig:

SY0AAB14YG23FM1 SY0AAB36YG05FM1 SY0AAB49YH08FM1
SY0AAB52YI05FM1 SY0AAB52YN11FM1 SY0AAC23YN19FM1
SY0AAC24YN22FM1 SY0AAC3YC15FM1 SY0AAC50YI12FM1
SY0AAC59YE24FM1 SY0AAC6YB13FM1 SY0AAC6YN08FM1
SY0AAC8YB13FM1 SY0AAD20YI12FM1 SY0AAD44YB09FM1
SY0AAD62YF15FM1