Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4067
Length(NT) : 823
Best Gene Model Blast : Link to GSTUMT00005403001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_501702.1| Score: 480 E_value: 2e-46
KEGG Definition: hypothetical protein
Accession: yli:YALI0C10967g Score: 480 E_value: 9e-47
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0666 Score: 370 E_value: 3e-36
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 181 E_value: 2e-14
Swissprot: Q6CCB0|SSN3_YARLI
Gene Ontology:
GO:0004693 = Molecular function: cyclin-dependent protein kinase activity
GO:0008353 = Molecular function: RNA polymerase subunit kinase activity

Sequence:
>Contig4067
TTGGCGCACGATACAAACGAAAAAAAAACTCTACTTACCTTAGACTGCCC
GTACTCTATCTTTAGACCGTGAATTACAGACTCTCACACACAGCCGAAGA
AAAGCATCACAGCTGACCACACGGGCAACATCGTTTTCAGGCTGATTTTC
AGGAGGAAAAAGCCCAGAATCCAGGCTTGATTGGAAGGCCTGTTGTATCA
GCGCATATCACAAAGAAAGCACACTACCGATTTGCCGCATGCAAAGAGCC
GAAGACAGGGAAGTTGACGACAAGGACGATCGCGGCGGAGGAAGACCCGG
TTTGCTTACCTCCACCTCGACCATCTTCAACACAATCACACCCACACAAC
ATCCTCCCTCGAAACGGAAGCGAGAAGGCACTCATCACGAAGAAGGTGAC
GAGGGCGAGGACGAGCAAGAAGAGGATCAAGAGGAAAGGGGTTTGCACGA
AGAGATAATGCCACCGTACAAAAGCAAGGTCAGAGTTCTCGAGGAGTATC
ATATCATTGGGTTTATATCTAGTGGTACTTATGGTAGAGTCTACAAAGCC
AGAAGCAAATTGCCTGGGAATACTAAAGAATATGCCATCAAAAAATTCAA
ACCGGACAAGGAAGGTGAAATCATTCAATACACTGGGATATCACAATCGG
CATGCAGAGAAATGGCTCTCTGTAGCGAGCTAAGCCACGAGAATGTAATT
CATCTCCATGAAATCATCCTTGAAGACAAGTGCATATATATGGTGTTCGA
GTATGCCGAGCATGATTTACTACAAATCGTACACTATCATTCTCACCCAG
AACGACGCCCGATACCCGAAGCA

Sequences in the Contig:

SY0AAC23YM10FM1 SY0AAC35YM21FM1 SY0AAD42YJ01FM1