Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4066
Length(NT) : 1526
Best Gene Model Blast : Link to GSTUMT00009800001 E-value : 0.0
Numbers of ESTs : 85

Blast Results:

Nr Definition: hypothetical protein BC1G_12947
Accession: ref|XP_001548552.1| Score: 1166 E_value: 1e-125
KEGG Definition: 1433_TRIHA 14-3-3 PROTEIN HOMOLOG (TH1433)
Accession: fgr:FG06847.1 Score: 1136 E_value: 1e-122
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0841 Score: 1019 E_value: 1e-111
PFAM Definition: 14-3-3, 14-3-3 protein..
Pfam Number: pfam00244 Score: 1130 E_value: 1e-124
Swissprot: Q99002|1433_TRIHA

Sequence:
>Contig4066
TTGGAGCGCACATAATTTCACAGAAAATCTGCTTGTTCCTAATTAGGCAG
TGATCGTCGGGCCTTGGCTGTTGTGTCCCCTTTCTCTCTGCCGCGCCCTC
TGCCCACACAACCCGCTTGCACGACTTGACCTGGCCCTCTTTCTTTCCCC
TTCCGCTTCGCCATCATTTGAAAGTCCTCCATCCTAACCGCTTCACACTC
CTCCTTCTCTCTCAAACTTCTTCCCCATCAACTACATCACACACTTGCCC
TTCTAATTCTGAGTTTCTCTATCACCGTCTATCTAACAACCTTATCAATA
CACTTTTCGACTGCAAAGTTTCACTAAAAAAATCAGTCAAAATGGGATAC
GAAGATTCTGTCTACCTTGCCAAGCTCGCCGAGCAGGCTGAACGTTATGA
AGAGATGGTTGAGAATATGAAGAACGTCGCATCTGCCGATCAAGAGCTTA
CTGTCGAGGAGAGAAATCTACTTTCTGTTGCGTATAAGAATGTCATCGGA
GCCCGCAGAGCCTCTTGGAGAATCGTGACCTCTATCGAGCAGAAGGAGGA
GTCGAAAGGCAACGAGTCTCAAGTTGCCCTCATCAAGGAATACCGTCAGA
AGATTGAAGCCGAGCTTGCAAAGATTTGCGAAGATATCTTAGAAGTCCTT
GATAAACATTTGATCCCCTCTGCTCAATCAGGAGAGTCGAAGGTCTTCTA
CCACAAGATGAAGGGTGATTATCACCGCTACTTGGCCGAGTTCGCTCTTG
GTGACAAGCGTAAGGAGTCCTCCGACAAGTCTTTGGAGGCCTACAAGAAT
GCTACCGAGGTTGCACAGACCGACCTTGCTCCTACTCACCCCATTCGCCT
TGGGCTGGCCCTCAACTTCTCCGTTTTCTATTATGAAATTCTTAATTCTC
CCGACCAAGCGTGCCATCTTGCCAAACAGGCCTTTGACGATGCAATTGCC
GAGCTCGACACCCTAAGTGAGGAGAGCTATAAGGATTCTACCCTCATCAT
GCAGCTTTTGCGAGACAACTTGACCCTCTGGACTTCGTCCGAGGCAGAAA
ACGACACTGCTGCCGACACTAACAAGGAAATGTCTGATGCTCCGGCCGCA
ACACCCGTCACCGAGGCTAAACCTGAGACCAAAGAATAAATTCTCTTGGG
GACGTGGCACGGCGGAGGGAAAATGAGGGGGGAACTGCAACCAAAAGGCA
TGGGTCATACAATGTGTTGGGGATAACTACGTTCTGGTTTCACTATGCTA
GGCGTTGACGCAAACTTTTCTCTTCTATCTGTTGGCCCAGACGTTCGGTC
TGTGTTTCTTTTTTCTCAAAGTTTCGTTCAATTCAACTTGTTGTCTTTTA
AAACTTTAAAGTCTGGTTCTGTGTTCTCTTGGCCTTACCCTATGTTATTT
TCTTGTTCCTCGGTTAGTGCTAGGTGCGGTTTTCACAGCCTTTTACTGTG
GTGTTTTAGCATGGTCTGGTTGTTCGATGAGAATTTTTACTTGTGCTGTA
GAATTTGATACAGATTCTTCGAAATC

Sequences in the Contig:

SY0AAA11YJ17FM1 SY0AAA14YL09FM1 SY0AAA19YE06FM1
SY0AAA24YB18FM1 SY0AAA24YB18FM2 SY0AAA24YN05FM1
SY0AAA24YN05FM2 SY0AAA24YN05RM1 SY0AAA26YE11FM1
SY0AAA32YH05FM1 SY0AAA33YL11FM1 SY0AAA34YD11FM1
SY0AAA34YE03FM1 SY0AAA36YC11FM1 SY0AAA3YG19FM1
SY0AAA41YC18FM1 SY0AAA41YF07FM1 SY0AAA43YP18FM1
SY0AAA44YO13FM1 SY0AAA45YD08FM1 SY0AAA49YP09FM1
SY0AAA50YG21FM1 SY0AAA55YM24FM1 SY0AAA60YK15FM1
SY0AAA62YK20FM1 SY0AAA7YA13FM1 SY0AAA8YB07FM1
SY0AAA9YM10FM1 SY0AAB13YP14FM1 SY0AAB14YE17FM1
SY0AAB15YH08FM1 SY0AAB16YH07FM1 SY0AAB16YL06FM1
SY0AAB27YA22FM1 SY0AAB29YG16FM1 SY0AAB2YG21FM1
SY0AAB33YI18FM1 SY0AAB34YK20FM1 SY0AAB37YA12FM1
SY0AAB40YO05FM1 SY0AAB42YE07FM1 SY0AAB42YL24FM1
SY0AAB43YF23FM1 SY0AAB46YB06FM1 SY0AAB47YN24FM1
SY0AAB51YJ21FM1 SY0AAB53YG18FM1 SY0AAB57YF03FM1
SY0AAB58YD04FM1 SY0AAB5YB09FM1 SY0AAC12YF15FM1
SY0AAC17YD03FM1 SY0AAC18YC06FM1 SY0AAC23YM05FM1
SY0AAC23YM17FM1 SY0AAC24YM05FM1 SY0AAC28YJ13RM1
SY0AAC28YN09FM1 SY0AAC28YN09RM1 SY0AAC30YL06FM1
SY0AAC3YM03FM1 SY0AAC45YI19FM1 SY0AAC47YC02FM1
SY0AAC52YJ07FM1 SY0AAC56YN08FM1 SY0AAC57YI23FM1
SY0AAC59YN20FM1 SY0AAC60YA22FM1 SY0AAC8YK06FM1
SY0AAC9YC03FM1 SY0AAD14YG16FM1 SY0AAD18YE11FM1
SY0AAD22YD20FM1 SY0AAD25YM21FM1 SY0AAD31YN04FM1
SY0AAD34YH18FM1 SY0AAD38YG14FM1 SY0AAD39YO17FM1
SY0AAD44YG13FM1 SY0AAD51YD09FM1 SY0AAD52YF17FM1
SY0AAD5YP16FM1 SY0AAD61YE14FM1 SY0AAD8YA11FM1
SY0AAD8YL19FM1