Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4065
Length(NT) : 507
Best Gene Model Blast : Link to GSTUMT00010039001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_04635
Accession: ref|XP_001223849.1| Score: 493 E_value: 2e-48
KEGG Definition: hypothetical protein
Accession: fgr:FG09767.1 Score: 479 E_value: 2e-47
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1150 Score: 197 E_value: 1e-16
PFAM Definition: DnaJ, DnaJ domain. DnaJ domains (J-domains) are associated with hsp70 heat-shock system and it is thought that this domain mediates the interaction. DnaJ-domain is therefore part of a chaperone (protein folding) system. The T-antigens, although not in Prosite are confirmed as DnaJ containing domains from literature..
Pfam Number: pfam00226 Score: 147 E_value: 9e-11
Swissprot: O74746|SPF31_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4065
TTGGCGCCAGCAACAACATGTCAGAAGAGGACACAGCGGTCGATAAGGAC
ATCCTAGCGGAGCTAGATAGGGAAGCATCTGATTACCTCAAGGCCACCAA
CTAATGCACTCACCCGTTATCAGGATGCCGAAATATCTCGAATCTTAAAT
GCTTTCAAATTAGATGCCTACGCAATCCTAGACCTAAAACCCGGCGTCCC
AGAATCCGACATCAAGCTCCAATTCCGCCGCAAATCCCTCCTTATCCACC
CGGACAAGACTAAGAACCCGCAAGCCCCCGATGCCTTCGACCGTCTCAAA
AAAGCACAGGGCGTGCTCATGGACGAGAAGGCGCGCACCCGTCTGGATGA
AGCGATCGCCGACGCGCGCATGCTACTCATCCGCGAGAAGAAGTGGACCG
TGGATAATCCAGAACTCACCGGCGAGGAATTCGCCGTGGAGTGGCGGGAG
AAGACCAAGTTTGTCCTGATCGAGAGCGAGTTGAGGAGGAGGAAGCAGGT
CAAGGCG

Sequences in the Contig:

SY0AAC23YK22FM1 SY0AAC44YE05FM1