Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4064
Length(NT) : 1509
Best Gene Model Blast : Link to GSTUMT00011012001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2051 Score: 120 E_value: 5e-07
PFAM Definition: No Hit Found

Sequence:
>Contig4064
TTGGCCCCCATCCATCCATCATCACCGCCCCCTTGGGCGTTCCAACTTCC
TGCGCTCACTCTTCCCAACAACATCCCCTTTCATTGTTTCTTTCTTTCTT
TCTTTCACCAATCACTCCGCGCAGCTTCCTGGCCTTATTTGAGCGACAAC
TTGACACCCGCGGAGCGCAAATTCAAATCATAATAACATGTCCGCCGCTG
CCGAGAATGCCGGAGGTGATAAAGCTCACTACAAATCTTACAAGAAGAAG
TATAAAAAGCTTCGCTTTAAGTTCGACCAGGTCATGAAACGCTCGGATGA
GCTCTTTAAGCAGGATCAAATCGCGTCCGCTGCAATTAGGCGTATACAAG
AAGAGAATACGCGTCTTCTGGATCTTCTGGTTGACTTGAATTCGTCCTCA
CATGTTCCCAAATCTCGTCGCTTTAACATCGGATCCCCCTCCGGTGCTAC
TCCGACCCGTTTTCTTTCGCCTACGCTACTTGCTGCTATGGGAGAATTGG
ATGAAGAGATTGCAGGCCTGGCTGGTGACAATGATGTGGAACCGATGCAG
CTGGAGCCAGGCCCTGTTAACGGTAACGATGCAGAGGCCGGAGATCAAGA
TGACAACAGCACTGATGACGATGATGATGATGATGAGGACGACGAAACTC
CGCCAATACAGCGCCACGGTGCGAAATACAGCGATGATGAGGATGAGGAT
ATGGACGATGATGACCGGGAAGCTTATCTCGAGGAGATACGTGAAACGAA
CCACAGGCGCGGAATCCCCGGGACACCGCCGAGATACATTCGGGACAAGC
TTAAGGCTGATGCAGAGAGAGAGAGAAAGGAGGCTGAGGAACAAGCTAAG
AAGGCCGCTGCTGAGGTTGCTGCGAATGGCGTCAATGGTTCTGCACCTCT
CGTGCTCAAGCAGGAGCCCGTCGACGAGATGCCTGAAGGTGTTCAGGAAC
CCGCCCCTCATACTCCTAATAATCGCAATCTTTTGGTGTTAGAGAATACT
TATCGTCGTGGCACTACCCCGCCTTACTTGCGCAATACCAGTCCCTTCTT
GATGTCTGTTGAGGAGGAGGACGCCTTCTATGCCAATGTCGACGAGAATC
TCAATGGGGAGATACCCACTTTGCCGGAAATTGTCCACACCTCTCCTAAT
GCTAGCAAGGGGGAAGGAGACCCACGAAACCCCATGAGCGTCTACTGCTG
GTTAAGGAAATATCAGCCACAAGTCTTCCTGCAGGAAACCGAAGGTGAGA
GGAAGCCCGGCAGGGGTAGGGGCGGCGGCAGACGCAGGGCCGCTGTTGAT
GCTGATTCCGGGGATGAAATGCCCTCCGGTGCTAAAGCTGCTGGGAGTAA
ACGCAGACGTGGTGAGGATGGTGAAGAGGCCCCAAATAGAGGTGGACGAG
GTCCCCGCGGGGGCAGAGGAGGCAGGAGAAAGCCTAATGAAGGTGGAGAA
CCACCGGTGAAAAAGCAGAGGAGTGTTGTCTGATAGCTAGGAAGCGAATT
GGATCTTCG

Sequences in the Contig:

SY0AAC17YH08FM1 SY0AAC23YK07FM1 SY0AAC24YB02FM1
SY0AAD46YH03FM1 SY0AAD4YL23FM1