Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4063
Length(NT) : 732
Best Gene Model Blast : Link to GSTUMT00009451001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3091 Score: 185 E_value: 6e-15
PFAM Definition: Glutenin_hmw, High molecular weight glutenin subunit. Members of this family include high molecular weight subunits of glutenin. This group of gluten proteins is thought to be largely responsible for the elastic properties of gluten, and hence, doughs. Indeed, glutenin high molecular weight subunits are classified as elastomeric proteins, because the glutenin network can withstand significant deformations without breaking, and return to the original conformation when the stress is removed. Elastomeric proteins differ considerably in amino acid sequence, but they are all polymers whose subunits consist of elastomeric domains, composed of repeated motifs, and non-elastic domains that mediate cross-linking between the subunits. The elastomeric domain motifs are all rich in glycine residues in addition to other hydrophobic residues. High molecular weight glutenin subunits have an extensive central elastomeric domain, flanked by two terminal non-elastic domains that form disulphide cross-links. The central elastomeric domain is characterised by the following three repeated motifs: PGQGQQ, GYYPTS[P/L]QQ, GQQ. It possesses overlapping beta-turns within and between the repeated motifs, and assumes a regular helical secondary structure with a diameter of approx. 1.9 nm and a pitch of approx. 1.5 nm..
Pfam Number: pfam03157 Score: 165 E_value: 1e-12

Sequence:
>Contig4063
TTGGCTCCCATCTGTTTTAGCTTCCCACTCTACTTCCCTCATCCACTTTT
CCTTCCCCAAACACATCTCCACTATAGAGAATCATCGCGATCATGTCCCT
CTTTGGCTCGACCTTTGGTCAGCCTCAGCAGCAGCAGCAGCAATCCCAAG
GTGGCGGCCTTCCCGAACAGCCAGCTGCGCAACAACCACAACAGAGCGGA
GGACTCTTTGGTGGCGCTCCTCAGCAGCAGCAGCAGAGCACAGGCGGTGG
TTTATTTGGCAGCCAACAGCCGCAGCAGCAGCAGCAGCAAGGCGGGCTTT
TCGGGAAACCTTCGGGGCTTTTCGGCCAACAGAGCACCCCAACAACCCAA
CAAGGAGGTGGCTTATTCGGAGGTGGTCAGTCTACTCAACAGAGCACTGG
TGGCGGCCTCTTTGGTGGCGGCGGTGGCGGCGGTGGGCAACAGAGTGCGG
GCGGAGGAATGTTTGGCAGTCAGCAGCAACAAGGTGGGCTATTCGGTGGC
GGTCAGTCGAGTCAACCTACTGGAGGTGGGCTCTTCGGAGGACAGTCAAC
TCACCAACCCCAGCAACAGTTCGGCCAGCAGGGTGGATCACTGTTTGGCC
AGTCGCGAACTGGGGGCGGCCTTTTCGGTCAGACGCCATCTCAACCTCAG
CAGCAACAACAGGGTGAGCTATTTAGCAATTCAACTGCAAATCAAGGACA
GCAGCAAGGATCCTATATGAATTCTACTATGG

Sequences in the Contig:

SY0AAA39YP15FM1 SY0AAB25YG13FM1 SY0AAC23YJ05FM1
SY0AAC35YJ24FM1 SY0AAD60YI20FM1